Тёмный
NexBuster
NexBuster
NexBuster
Подписаться
Hello, I make edit videos about Tokusatsu and Shonen... and other 'exquisite' stuff.
oh also I use CapCut as my editing app if you're wondering.
Комментарии
@muhammadilyas-ir3hc
@muhammadilyas-ir3hc 5 дней назад
And i'm sigma🤫🧏
@gilbertmoreno1214
@gilbertmoreno1214 7 дней назад
Hahahahahahahahahahahahahahahahahahahahahahahahahaha
@cashbrady4074
@cashbrady4074 7 дней назад
kuuga takes speed easily imao
@Sir_carbos_detur99
@Sir_carbos_detur99 18 дней назад
Shortest of the asian zodiac
@Brócoli_Z
@Brócoli_Z Месяц назад
Machine once I revert to an egg I must bury myself in limbo for three years, there my angelic form matures
@cashbrady4074
@cashbrady4074 Месяц назад
it is a kids show but depends on the show
@Rinold_andres
@Rinold_andres Месяц назад
Kamen rider black sun is also pg
@TheKINGshot36
@TheKINGshot36 Месяц назад
All team in kamen rider amazon show: omega alpha neo sigma
@Rinold_andres
@Rinold_andres Месяц назад
All riders not team
@Fireblaze2077
@Fireblaze2077 Месяц назад
Nice 👍
@VenomVenomVenom95
@VenomVenomVenom95 Месяц назад
old kr are all dark
@mclovin91
@mclovin91 Месяц назад
Basically a Ryuky top strongest characters
@niilasyukriilah5350
@niilasyukriilah5350 Месяц назад
I hate this viseo
@WenderDiasRocha-yp8ek
@WenderDiasRocha-yp8ek Месяц назад
Qeu bonitinha
@TheBloodGamePL
@TheBloodGamePL 2 месяца назад
Immediately incorrect as we all know Kamen rider Scissor is outherversal. He is Scissorversal
@TreasureGD
@TreasureGD 2 месяца назад
Welp it’s also time for me to bring out the atomic cannon💀💀💀💀💀💀
@TreasureGD
@TreasureGD 2 месяца назад
Proceeds to die of cringe💀
@-Nexternal-
@-Nexternal- 2 месяца назад
@@TreasureGD 💀
@EfrainEscorcia-f8r
@EfrainEscorcia-f8r 2 месяца назад
Fffggg❤❤❤❤
@joshuadesousa6668
@joshuadesousa6668 3 месяца назад
How we expected Cell to look when he absorbed 18 🤣
@venomtrymto1234
@venomtrymto1234 3 месяца назад
Bro think he is Reimu🐧
@BryanRosati
@BryanRosati 3 месяца назад
This Is My Favorite monsters of every monsters of Godzilla shin hedorah ❤
@allgoodnamestaken6002
@allgoodnamestaken6002 3 месяца назад
>uses a spinoff series that was explicitly aimed at adults to refute the (very true) statement that Kamen Rider in general is aimed at kids Okay man.
@-Nexternal-
@-Nexternal- 3 месяца назад
Ya really took it seriously, huh? Astonishing. It's just a measly pathetic edit of mine, and the video itself doesn't have any statement of Kamen Rider being a kid show, it's just the title.
@Dragongamez128
@Dragongamez128 3 месяца назад
The "AAAAAUUAUUAUAUAAUAUAGGAGAGAGGA" is fuking funny😂
@Train244
@Train244 3 месяца назад
Cool?
@shinrodanreviews4322
@shinrodanreviews4322 3 месяца назад
Remember everyone, Kamen Rider Amazon was not made for kids. So you can’t really compare it to mainline Rider, which IS made for kids (all ages if you ask me).
@HaloHalo-rn6zo
@HaloHalo-rn6zo 3 месяца назад
Epic 🤘👍
@Fireblaze2077
@Fireblaze2077 3 месяца назад
That 1% of Kamen Rider
@Galang_Djatmiko.18
@Galang_Djatmiko.18 4 месяца назад
Can you please give some more power to meeeeeeeeeeee!!!!!💎🤟😍✨
@ILovemy_fans-i3z
@ILovemy_fans-i3z 4 месяца назад
Pov blazer roar Ultraman blazer:*random dinosaur ahh bird sound*
@ILovemy_fans-i3z
@ILovemy_fans-i3z 4 месяца назад
AhHhHh Ou mAaAaA zOoOoOn
@gerryabueva1533
@gerryabueva1533 4 месяца назад
Bruh💀
@mikelquinnr6101
@mikelquinnr6101 4 месяца назад
🥶🥶🥶😲
@Ultimatelazyedit
@Ultimatelazyedit 5 месяцев назад
Nice edit
@joncandib1721
@joncandib1721 5 месяцев назад
I love that song
@your_father19
@your_father19 5 месяцев назад
cell getting android 18s cells
@Kingmomotaro
@Kingmomotaro 5 месяцев назад
Amazons es para adultos y fourze es lo más cercano a un show para niños
@Raptor_animation
@Raptor_animation 5 месяцев назад
Man good thing in season 2 he cant see but hear people movements
@Door227
@Door227 5 месяцев назад
“I just think military coups are pretty pog”- Douglas Douglas wreden 2024
@Door227
@Door227 5 месяцев назад
The presentation should’ve included Pointcrow playing all of tears of the kingdom as a postgame
@venomtrymto1234
@venomtrymto1234 6 месяцев назад
A lord of darkness vs a demon just spam his fist💀🔥
@blusowka
@blusowka 6 месяцев назад
That minecraft skin
@animeboy200p2
@animeboy200p2 6 месяцев назад
Smash next question to the female cell 🗿
@NonFatFroggo-hw3ls
@NonFatFroggo-hw3ls 6 месяцев назад
Nice takes! Personally, this would be my list from weakest to strongest: Scissors>Imperer>Raia>Femme>Taiga>Gai>Zolga>Ouja>Ryuki=Ryuga>Knight >Odin. I put Gai so high up on the list because of his negate Vent Cards and his physical strength. After all he managed to get all the way to Ryuga in Rider Time. I put Ryuga on par with Ryuki because, from my perspective, he’s a true negative version of mirror of Ryuki/Kido due to the fact he ENJOYS fighting. He enjoys killing other Riders. With that mentality, he ranks stronger than Ryuki initially, while Kido has his goodness of heart. One isn’t stronger than the other. I put Knight higher than Ryuki due to the fact that Ren has more battle experience than Shinji. If I recall, he was Knight for like a month or two before he met Shinji? Plus, he gives off the vibe that, every time he fights, he knows what he’s doing and is prepared for it. While they’ve fought 3 times before, I still think Knight’s stronger, albeit barely.
@manhwaboss1473
@manhwaboss1473 4 месяца назад
imperer is quite formidable dude
@OuterRoutersillyness
@OuterRoutersillyness 6 месяцев назад
FUNNIEST SHIT I'VE SEEN
@ItsChevnotJeff
@ItsChevnotJeff 6 месяцев назад
Cell but he has 1% more Frieza DNA than usual
@GoldenwarProductions-vk4cj
@GoldenwarProductions-vk4cj 6 месяцев назад
Goated show
@nekozimo
@nekozimo 6 месяцев назад
Naaaah
@RyuNexFBT
@RyuNexFBT 6 месяцев назад
💀
@chicken_tender218
@chicken_tender218 6 месяцев назад
first
@saramartinez1682
@saramartinez1682 7 месяцев назад
This is how Cell's Spirit for Female Cac (Dragon Ball The Breakers) is born.