Тёмный

3 camera tricks NO ONE will suspect! 

Peter McKinnon
Подписаться 6 млн
Просмотров 1,7 млн
50% 1

NEW Lightroom PRESET PACK: goo.gl/1CfEKF
The Music I use: goo.gl/IMZC9A - AMAZING for RU-vidrs
Colour Graded with my PM LUTS Pack : goo.gl/JmUrM7
PM MERCH & COFFEE! : goo.gl/TkzM6S
My 2019 KIT for Filmmaking, Photography & Vlogs:
Camera Bag: amzn.to/2MafNtQ
Camera Bag Organizer Pouches: amzn.to/2suAQ0Z
GoPro Hero 7 : amzn.to/2M7WSzV
My Drone : amzn.to/2spuHDx
My Smaller Drone : amzn.to/2MdxOHF
ND's For my Drone: amzn.to/2VSwkHl
ND Filters: amzn.to/2M9M6ZX
Cheaper Filter Case: amzn.to/2Fsf5Ys
Main Vlog Camera: amzn.to/2RMov6D
Photo / Timelapse Camera 2: amzn.to/2M8W0uS
VLOG LENS! : amzn.to/2Fsiuqi
Magic ZOOM LENS OF LIFE: amzn.to/2ChiDZi
Gnarly 28-70 Lens: amzn.to/2ChiJA8
DOPE B Roll Lens: amzn.to/2VUQVeb
Small Roll of Gaff Tape: amzn.to/2RPUJy6
Aputure AL-MX Light: amzn.to/2VSj9pJ
3 Legged Thing Tripod: amzn.to/2D9dd4v
Cheap alternative to expensive Time-lapse remote: amzn.to/2Dava2z
Expensive Time-lapse Remote: amzn.to/2VUq6GI
Rode Video Mic Pro Plus: amzn.to/2RMROWF
Think Tank Memory Card Organizers: amzn.to/2st9bO2
Think Tank SD Organizers: amzn.to/2Mgvlwl
Samsung T5 SSD Drive: amzn.to/2MbSqQp
FOLLOW ME:
Instagram: / petermckinnon
Twitter: / petermckinnon
Facebook: / petermckinnonphoto
Website: www.petermckinnon.com

Опубликовано:

 

20 янв 2019

Поделиться:

Ссылка:

Скачать:

Готовим ссылку...

Добавить в:

Мой плейлист
Посмотреть позже
Комментарии : 2,4 тыс.   
@PeterMcKinnon
@PeterMcKinnon 5 лет назад
BAM! Always be looking for that surprise! Hope you enjoyed :)
@softwayre
@softwayre 5 лет назад
Hi Friend
@UsmanShafiqueVlogs
@UsmanShafiqueVlogs 5 лет назад
Peter McKinnon Booooom 🕺🏼🕺🏼🕺🏼
@lifeksquared4565
@lifeksquared4565 5 лет назад
Always
@kozy810
@kozy810 5 лет назад
Peter McKinnon dang posted only 3 minutes ago! Let’s go!!!!
@ryans_life
@ryans_life 5 лет назад
You know it! Smashed it 👊
@DolisterCovers
@DolisterCovers 5 лет назад
"With no cameras" as he's vlogging 😂
@OutofOfficechannel
@OutofOfficechannel 5 лет назад
I just thought the exact same thing hahah
@shameemaroma3735
@shameemaroma3735 5 лет назад
Vlog life 😂😂
@coltonbushue
@coltonbushue 5 лет назад
its ya doli boi out here with the top comment
@larryl
@larryl 5 лет назад
Ahhhh I came to write the same thing !!! LOL love it
@DolisterCovers
@DolisterCovers 5 лет назад
@@coltonbushue I DIDN'T EVEN KNOW THIS WHAT
@alajode
@alajode 5 лет назад
I asked someone to help me with these... but they ran away with my camera.
@deeyammy783
@deeyammy783 5 лет назад
best comment
@michaelkent7102
@michaelkent7102 5 лет назад
When you follow Jodie and Brendan and randomly find Jodie in the comments of a PM video 😁
@perimaster8016
@perimaster8016 5 лет назад
But did you get the shot though?
@wanderingsoul1198
@wanderingsoul1198 5 лет назад
Haa Haa Haa
@alajode
@alajode 5 лет назад
@@michaelkent7102 You just never know where you're going to find me..
@Hiaki1000
@Hiaki1000 5 лет назад
Peter: Birdwatching with like no cameras Also Peter: Filming a video with a camera
@bobcloughjr
@bobcloughjr 4 года назад
Lol
@Ell_lovell
@Ell_lovell 4 года назад
Me: I AM CONFUSION TOO!!
@mika2666
@mika2666 4 года назад
*pulls out 600 f4*
@GrandisSilva
@GrandisSilva 4 года назад
Did he see an eagle??
@BellsRidesAboardSeaBoss
@BellsRidesAboardSeaBoss 2 года назад
MY FAVORITE COMMENT, LMAO
@angwishedmedia3972
@angwishedmedia3972 4 года назад
These “tricks” involve having friends.
@whiteswanlol9086
@whiteswanlol9086 4 года назад
Feeling bad for u guy U okay?
@angwishedmedia3972
@angwishedmedia3972 4 года назад
@@whiteswanlol9086 Yeah, I'm good. Let'a just say that this "quarantine" period I'm enjoying. Not much of an extrovert.
@whiteswanlol9086
@whiteswanlol9086 4 года назад
@@angwishedmedia3972 You're right
@MohdAkmalZakiIO
@MohdAkmalZakiIO 4 года назад
...that knows handling camera/s.
@parsasalmasy
@parsasalmasy 3 года назад
AngWished Media ayyy bro same, I lowkey like this quarintine. It’s so peaceful and self alone time which is bless
@JayneNicoletti
@JayneNicoletti 5 лет назад
This video proves that behind every successful person is a great team.
@khuramshahzad7374
@khuramshahzad7374 5 лет назад
Right
@tonyadky3792
@tonyadky3792 5 лет назад
Ya
@Ben-rz9cf
@Ben-rz9cf 4 года назад
And behind every great team is Jason Voorhees with a machete
@Robsn
@Robsn 4 года назад
Hey I made a video about camera hacks rn! Have a look if you want :-) Would appreciate it!
@lvm182
@lvm182 4 года назад
@@Robsn dude honestly why do you hype it up if its not even in English. At least do this at your local creator's comment page.
@thechrishau
@thechrishau 5 лет назад
You sure you just don't have a floating camera? I'm gonna go with a floating camera. haha awesome as always homie.
@PeterMcKinnon
@PeterMcKinnon 5 лет назад
Don't give it away dude. We talked about this..... ;)
@Creek5Romeo
@Creek5Romeo 5 лет назад
What about a spy camera in the McDonald’s bean sludge cup?
@johndavidtackett
@johndavidtackett 5 лет назад
Hmm 🤔 I remember Pete “floating the camera” while holding a hotdog on the 1st DopeSquad episode when you shared the Pass the Pigs game (I thought I was the ONLY person who kept that on me in my sunglasses case everywhere I go lol) and it looked freaking sweet then and it looks freaking sweet now!!!!! 😎
@ANAKCreates
@ANAKCreates 5 лет назад
link in the description??
@TheVADstudio
@TheVADstudio 5 лет назад
😂😂😂😂😂
@Lilylikecom
@Lilylikecom 5 лет назад
this video is too good. you're literally a camera magician lol
@HadiFilms983
@HadiFilms983 2 года назад
Haha so true😂😂😂
@SusannahPerri
@SusannahPerri 3 года назад
OMG, Peter, I have watched SO many of your videos over the past couple of years, but just saw this one for the first time. It is one of my FAVORITES!! I had a smile and laugh the whole time I watched. Please never stop making videos, you are such a joy and inspiration! Big cyber hugs to you!
@DavidWeder
@DavidWeder 5 лет назад
Yeah everyone has this one friend who's always waiting at home so he can be your assistant when ever you need him.
@jgwulfert
@jgwulfert 5 лет назад
Yeah everyone has.....
@skydaddy4192
@skydaddy4192 5 лет назад
Unfortunately, i am that person. It's not like i love doing it, I just have nothing to do.
@ZER-cr4dm
@ZER-cr4dm 5 лет назад
Yeah no one likes doing it
@sunflowerc9560
@sunflowerc9560 4 года назад
😂😂😂
@shinichixxxx
@shinichixxxx 4 года назад
more like studio
@tj44017
@tj44017 5 лет назад
I've found the best photographer/cinematographer.
@rahuls.krishnan4565
@rahuls.krishnan4565 3 года назад
Nice! @him please
@xtonibx5770
@xtonibx5770 3 года назад
@@rahuls.krishnan4565 💀
@natedicamillo3440
@natedicamillo3440 3 года назад
/magician
@TenthElementGraphics
@TenthElementGraphics 4 года назад
All these tricks require having a friend. Guess I'll wait for the next video.
@timetravel2390
@timetravel2390 5 лет назад
''I Mean I will probably still drink the whole thing'' yup, relatable hahahaha
@ANAKCreates
@ANAKCreates 5 лет назад
haha yupp, totally know what he means. Basically everyday. haha
@paulwatrobski8277
@paulwatrobski8277 5 лет назад
Notice how right before/as he said that he put one cup down and then picked up another/a different cup?
@ANAKCreates
@ANAKCreates 5 лет назад
@@paulwatrobski8277 haha yes, he had 2 of them!! like of course hes gunna drink the whole thing..
@AndreaJean
@AndreaJean 5 лет назад
Time Travel ha ha yep me too!
@LEZOMY
@LEZOMY 5 лет назад
Instructions not clear: I tried the floating camera now its broken into pieces.
@Auxemplary
@Auxemplary 5 лет назад
Yea it doesn't work when you have no friends
@sweetgem__
@sweetgem__ 5 лет назад
😂 ^
@evanbutler6465
@evanbutler6465 5 лет назад
@@Auxemplary ooof dude
@Karimsemeda
@Karimsemeda 5 лет назад
متعملهاش تاني يا أسطورة 😂
@fathurrizki6551
@fathurrizki6551 5 лет назад
@@Auxemplary true A.F
@christopherpackart
@christopherpackart 5 лет назад
"Casey told me this once which I really took to heart." *points at head 6:44
@tonyadky3792
@tonyadky3792 5 лет назад
😂
@ranjan_v
@ranjan_v 4 года назад
I need observation skills like you
@guyincognito5706
@guyincognito5706 4 года назад
Christopher Pack Art believe that meant he heard it, or was telling us to listen
@pushkarbelsare7245
@pushkarbelsare7245 4 года назад
Guy Incognito but 😂
@twoline567
@twoline567 5 лет назад
Tells camera: "I am bird watching without any cameras" You fooled me
@GawxArt
@GawxArt 5 лет назад
Thank you so much for sharing this tips to us and inspiring me to make videos❤️ you’re awesome
@TheJubileeDiaries
@TheJubileeDiaries 5 лет назад
Doodle.
@bertjes2
@bertjes2 3 года назад
Look at you now, crazy
@colinalexanderd
@colinalexanderd 5 лет назад
Well done! I definitely wasn’t expecting the last one. And the little BTS sequence at the very end was just some good, clean fun
@wizcombo
@wizcombo 5 лет назад
Colin Alexander nice workout lol
@TheGrizzlyGarage
@TheGrizzlyGarage 5 лет назад
So basically hire a little dude to follow you around to get that extra spicy vlog. LOL.
@loveinatincanclintericka
@loveinatincanclintericka 5 лет назад
I love how excited and passionate you are about these! It's infectious and makes us want to try it too!
@LionelChambers
@LionelChambers 5 лет назад
the montage at the very end where peter keeps on looking back at the camera after walking away is gold haha
@DuncanSmith
@DuncanSmith 5 лет назад
That episode 1 title 🙌🏻🙌🏻🙌🏻
@AdrianWardhanaa
@AdrianWardhanaa 5 лет назад
Thanks Peter!
@HaleyLafaye
@HaleyLafaye 4 года назад
I think my favorite part of most of Pete's videos are the ending clips like behind the scenes and bloopers... and ya know the camera stuff is pretty dope too...
@NickIby
@NickIby 5 лет назад
Well now 2.9 million people will suspect it... 🤔
@PeterMcKinnon
@PeterMcKinnon 5 лет назад
Damn. You’re right. Hahahaha ;)
@shameemaroma3735
@shameemaroma3735 5 лет назад
😂😂
@JosiahVaughan
@JosiahVaughan 5 лет назад
😂😂this comment is golden
@swiftproductions5241
@swiftproductions5241 5 лет назад
I literally clicked on this video just to make this comment but I see you've beat me to it. Fair play.
@adamconstanza
@adamconstanza 5 лет назад
Your vids never disappoint bro! And now I'm gonna try incorporate something similar into my next vid. You keep teaching, we keep learning. 👍
@RobbieBackpacking
@RobbieBackpacking 5 лет назад
The Subtle Art of Camera Tricks! Loving it!
@evanfinley2905
@evanfinley2905 5 лет назад
I Like the fresh vibe for 2019! Thanks for all the great content!
@BestBrandsPerfume
@BestBrandsPerfume 5 лет назад
I just love these camera tricks, I once used the one where you snap your fingers and your clothes change, you taught me that too. You could have a camera master class people would pay big money. I want a discount since I know you though.
@MarriedwithWanderlust
@MarriedwithWanderlust 5 лет назад
GOOD EVENING AND HAPPY NEW YEAR FROM SOCAL. Love the tips and can't wait to use them on the next vlog. Thanks for everything Peter. Travel More! Worry Less!
@BookerLeslie
@BookerLeslie 5 лет назад
Love this Peter!! Some of my favorite videos are when you show these tips/tricks.
@ChinchillaByte
@ChinchillaByte 3 года назад
Here I am trying to learn to make more interesting videos & you're literally showing me things I've never noticed that make such a big difference. Thank you Peter!
@FotoFinn
@FotoFinn 5 лет назад
Now every shot of you vlogging I just can't trust that you won't sudden'y let go and let us float away 😂
@NorikGaming
@NorikGaming 5 лет назад
I would love to see more BTS, it's interesting to see how things are done. Love the work Peter
@Victoriaro
@Victoriaro 5 лет назад
I was so surprised by the first one 🙈 Great!!!
@abdullahhassan9382
@abdullahhassan9382 4 года назад
I feel like that studio has a special place in my heart, I enjoy vlogs taken there. 💔
@Deviajeconlacamara
@Deviajeconlacamara 5 лет назад
New camera bag ? I think you are preparing a big surprise about this.
@MikeLunc
@MikeLunc 5 лет назад
You big little goof! Love the energy as always!
@sophieshen6054
@sophieshen6054 4 года назад
You are so great!! can't imagine how many efforts behind the scene to make this tutorial which is so easy to understand and fun to watch.
@arquivofranklinmedrado
@arquivofranklinmedrado 5 лет назад
Excelent video 👏👏👏👏.
@faizanraza583
@faizanraza583 5 лет назад
6:46 says "Took to heart" and points to head. You gotta love Peter
@davegrbic
@davegrbic 5 лет назад
The last 30 seconds showing BTS...thank you for this. I've never seen anyone share these raw clips before and it's just nice to see how in reality things are as normal as you think, just down to post editing. Peter always keepin it real - thanks brother!
@AAvfx
@AAvfx 3 года назад
*I needed that! Thanks* ☺️
@robertdronum7961
@robertdronum7961 5 лет назад
OH MA GAWDDDD!!! That episode 1 effect at the beginning was A M A Z I N G!!
@RunNGunPhoto
@RunNGunPhoto 5 лет назад
I *DID NOT* see that 3rd one coming! hahaha! Awesome as always Peter!
@dibees
@dibees 5 лет назад
What was the 3rd one? I'm so lost
@GoProMeetsAeon
@GoProMeetsAeon 5 лет назад
yea whats the last one? Just mounting it onto the car via Gorillapod?
@filmmaker_howl1342
@filmmaker_howl1342 5 лет назад
he said it`s surprise,3rd one is surprise,so there`s no third one , surprised? you got it?
@PaulaHeartland
@PaulaHeartland 5 лет назад
His friend drove. That's why he had to secure his camera 🤣
@leonwong95
@leonwong95 5 лет назад
noticed there's no people in the car while he shooting :P
@frittern7013
@frittern7013 5 лет назад
No friends? No problem ;) Use a tripod with weels and create the same effect🙌
@CoalitionGaming
@CoalitionGaming 5 лет назад
A Dolly :)
@ronnation630
@ronnation630 5 лет назад
Solid
@unclebobbyb3917
@unclebobbyb3917 5 лет назад
No friends
@asjaljunejo3174
@asjaljunejo3174 5 лет назад
He is like us No friends
@bendixtrinity8337
@bendixtrinity8337 5 лет назад
and it tips over. pentagon hexagon careergon.
@spencerrr9878
@spencerrr9878 5 лет назад
Okay honestly #2 went over my head at first 😂 😂
@jasonamorris6
@jasonamorris6 5 лет назад
I would love to see more unedited raw behind the scenes. (from other angles) For me, that was very interesting and almost a sign of relief and a boost of confidence. While doing vlogs, I myself and I know thousands of other people feel very awkward talking into the camera and everytime I watch your vlogs, I'm almways soooo jealous. Seeing the raw behind the scenes from another angle gives me that extra boost of confidence. Maybe it's just me.
@caravanlifenz
@caravanlifenz Год назад
I saw a Pewdiepie interview once, and he said he was so shy in the first videos that they don't even feature him speaking at all (just playing video games). But it slowly became more natural talking and recording himself after he made a video every day.
@ErykLapitz
@ErykLapitz 5 лет назад
One of my favorite channels on RU-vid. Literally, inspired me to make my own channel 🙏 Thanks Peter
@PeterMcKinnon
@PeterMcKinnon 5 лет назад
You're welcome! Don't forget to have fun with it!
@dwitkowska
@dwitkowska 5 лет назад
Your joy is contagious, Pete. Thx 😍
@dntliecate
@dntliecate 5 лет назад
He makes me want to do better
@ErykLapitz
@ErykLapitz 5 лет назад
Marycate Masilela makes you want to make best video ever
@ErykLapitz
@ErykLapitz 5 лет назад
Peter McKinnon Most definitely ! 🤟
@ThisIsTechToday
@ThisIsTechToday 5 лет назад
Oh, man. These are so much fun! BTW, who's the friend helping film?!
@Hectoralejandroguerrero
@Hectoralejandroguerrero 5 лет назад
This is Tech Today incredible !!!!
@Jupiter2ignite
@Jupiter2ignite 5 лет назад
What's up sir
@ThisIsTechToday
@ThisIsTechToday 5 лет назад
Hey, Hector and Chris! I see we all have amazing taste. Peter is incredible.
@Jupiter2ignite
@Jupiter2ignite 5 лет назад
@@ThisIsTechToday herooooo
@NohohonFTW
@NohohonFTW 5 лет назад
I think its Kirk Lepiten, he is really good! Maybe he is his Editor? Pete never told us 🤷‍♀️
@firinglinechannel
@firinglinechannel 4 года назад
Good stuff! I always get to excited and just shot the info for my vids and put the details on the back burner. Definitely have to work on that
@solkrush779
@solkrush779 3 года назад
Always love learning from your videos ♥️
@benjaminsolomon461
@benjaminsolomon461 5 лет назад
Well now that Peter made this video, everyone will suspect these tricks 😂
@benbelindajacktom4887
@benbelindajacktom4887 5 лет назад
You're an inspiration Peter. Our entire family get inspiration from your positive videos and I'm always learning when watching your good self. Keep up the inspiration. Thanks Mate
@samsmith2279
@samsmith2279 5 лет назад
Spot on! A very inspiring man who is willing to share knowledge. Thank you
@nicholasb9424
@nicholasb9424 5 лет назад
Sam Smith I think that’s my favorite thing about Peter (well besides his personality and awesome content of course)-he’s a creative that believes in sharing the knowledge. I’ve come across so many other creatives irl that want to keep things to themselves and not share the wealth. It’s really distasteful in my opinion...but then there’s Pete:) Entertaining while Inspiring.
@poppylane156
@poppylane156 5 лет назад
Ditto, I really get a lot out of your videos too. Thanks
@damemesquad5021
@damemesquad5021 5 лет назад
So true. One of the best channels on RU-vid is this. Peter thank you for sharing all your expertise with a camera.
@bezvodivka
@bezvodivka 5 лет назад
Thank you Peter! I will try it.
@GreasyBoysGarage
@GreasyBoysGarage 5 лет назад
So NO one got those tricks?? I thought that they were the easiest ones to spot! I even decided I liked it so much that I used it in one of my own vids...Great Job Pete!
@MJ98.
@MJ98. 5 лет назад
#1 have a friend 👍
@anthonyisensee
@anthonyisensee 5 лет назад
Guess that's gonna be a no go for me. :T
@seanbilly22
@seanbilly22 5 лет назад
Goteeeeeeeeeeeeeeeeeeeeeeeeem
@jaybelmar3830
@jaybelmar3830 5 лет назад
You need an award for teacher of the year! Thanks for making these videos, especially for those of us who haven't been in a classroom in forever or maybe never.
@GeekRobotYT
@GeekRobotYT 5 лет назад
I really like the last one! Think I’m going to try it out for myself
@sammoffoot888
@sammoffoot888 5 лет назад
3AM two options: -> sleep -> watch yet another BANGER by peter think you could guess which I picked
@s101077
@s101077 4 года назад
Just goes to show ,how important a trustworthy friend is bro
@JeremiahStringer
@JeremiahStringer 5 лет назад
Love the video. Can't wait to use the tricks in some vlogs! Appreciate it!!
@lumbanimunthali1549
@lumbanimunthali1549 5 лет назад
So subtle, yet so VERY EFFECTIVE! Great video man, thanks for showing the BTS bits too. Looking forward to future content!
@dominatingsole1775
@dominatingsole1775 5 лет назад
This video made me reach for my coffee. I wish I had coffee
@InternationalBassStation
@InternationalBassStation 5 лет назад
...you can stay
@BradyuNunez
@BradyuNunez 5 лет назад
Almost at 3 mil my dude
@Ralphandlouvlogs
@Ralphandlouvlogs 5 лет назад
We stop at that cafe whenever we visit grandmas lol! Good stuff ☕️👌🏼Definitely going to try these tricks to make our vlogs more interesting!
@jennyupabove
@jennyupabove 5 лет назад
This was awesome. I'm going to be looking out for so much in your videos from now on.
@brickdaddiy
@brickdaddiy 5 лет назад
Here I was thinking I needed some kind of rig, and I just need a friend
@BikingWithCraig
@BikingWithCraig 4 года назад
Once Upon A Workbench for me a rig would be easier to find 🤣
@RohitVinay
@RohitVinay 5 лет назад
Your first camera tricks video is the reason I subscribed to you, I tried to use those in my art channel.
@ConnorEckdahl
@ConnorEckdahl 5 лет назад
Same, but I cut open my lens with my knife... :/
@Itsjessieleeee
@Itsjessieleeee 3 года назад
I just found your channel by a friend telling me about it. Love it!! Can't wait to learn filming tips and tricks!
@ThePhiCode
@ThePhiCode 5 лет назад
the End was hilarious ... thanks for your unique content Peter! ❤️
@MaxDiamond
@MaxDiamond 5 лет назад
I saw that third one coming, I was like why is he standing in the bed of his truck?? haha Great video Pete
@ZER-cr4dm
@ZER-cr4dm 5 лет назад
What did he do? He just put it on the truck and move it
@musictamaulipas6319
@musictamaulipas6319 5 лет назад
Doctor Who Cares you have to listen carefully
@ZER-cr4dm
@ZER-cr4dm 5 лет назад
@@musictamaulipas6319 Cant you just tell me?
@naeemcharania8996
@naeemcharania8996 5 лет назад
idgi
@Mrdennismalloy
@Mrdennismalloy 4 года назад
He subverted your expectations, by not giving you #3
@Smithsgold
@Smithsgold 5 лет назад
Great tricks
@AkhilMantra
@AkhilMantra 4 года назад
Superb... You are taking the vlogging to the next level. Your work is helping us think differently. Truly amazing... Love you..God bless you.
@FrostDrive
@FrostDrive 4 года назад
These are some INSANELY creative tricks Peter! So cool of you to share, Im gonna try it out now thank you!! :"D
@yammi385
@yammi385 4 года назад
0:10 "I'm actually bird-watching. With like... no cameras" Then it cuts to b-roll. With no cameras huh? 🤔
@TheFriendlyReviewer
@TheFriendlyReviewer 5 лет назад
Great stuff - is this when you broke your lens with the Joby?
@Jmschnider
@Jmschnider 5 лет назад
I doubt it being in this video the joby was already broken
@sinjon
@sinjon 5 лет назад
No the jobs broke when it fell off a counter. It damaged one of his lenses too. He talked about it in his camera bag video
@NensNick
@NensNick 5 лет назад
Very creative techniques! Thank you for this knowledge Peter :)
@Vejur9000
@Vejur9000 3 года назад
Your energy is infectious, Peter.
@MichaelNNguyen
@MichaelNNguyen 5 лет назад
You can also try this using a Manfrotto monopod.
@Tipster49
@Tipster49 5 лет назад
0:09 “I’m actually bird watching, with like no cameras...” as you talk into a camera
@fuego604
@fuego604 4 года назад
Good catch .. lol
@johrelmaximiano
@johrelmaximiano 5 лет назад
You're freaking awesome dude! I'm so inspired right now! More power to your channel!
@waderaudi
@waderaudi Год назад
When I watch this dudes content, i see so many things that I want to represent with my own Photography. Just the absolute general love for photography and making content. Not for being recognised for it, but for recognising my own inner ambitions and artistic eye. That is true success.
@catcatcatcatcatcatcatcatcatca
@catcatcatcatcatcatcatcatcatca 5 лет назад
This may sound rude, but the first one is so believable because people naturally assume vloggers don't have friends. (when filming)
@DontKnowLetsGo
@DontKnowLetsGo 5 лет назад
Awesome as usual, Thanks Peter.
@Hectoralejandroguerrero
@Hectoralejandroguerrero 5 лет назад
Don't Know? Let's Go always learning bro!!
@DontKnowLetsGo
@DontKnowLetsGo 5 лет назад
@@Hectoralejandroguerrero true true, never stop.
@davidedinoi3468
@davidedinoi3468 5 лет назад
...aaaaaaaaaaand saved (as always) in the "very important video" playlist. Thanks for all, man. Hugs from South Italy.
@blessedisphenomenal
@blessedisphenomenal 5 лет назад
Thank for putting in so much work into your video for viewers to enjoy
@lapzap8127
@lapzap8127 5 лет назад
How did he get in truck while he was in ground??😉😉😉
@leonwong95
@leonwong95 5 лет назад
Casey went in the car while Peter opening the back door?
@SirPhoebus
@SirPhoebus 5 лет назад
What ? He opens the back door, climbs up, puts the cam down, climbs down, someone drives away. He showed all this where are you confused ?
@4shortpants646
@4shortpants646 5 лет назад
Misdirected
@myke.p
@myke.p 5 лет назад
@6:38
@sinjon
@sinjon 5 лет назад
SirPhoebus its a joke
@Ryansacrobat
@Ryansacrobat 5 лет назад
I actually did the floating camera once and thought it was a great idea, but NOBODY noticed! :(
@Ryansacrobat
@Ryansacrobat 5 лет назад
@@drewholmes9946 Well of course, but additionally, I dont have the same amount of people watching/commenting so naturally, that would be one of the effects that wouldnt be immediately called out.
@MaikKleinert
@MaikKleinert 5 лет назад
Just keep doing it in your videos from time to time. A lot of people are regains it but there are to lazy to comment ;-) Hope you had fun creating the floating move that's all at the end! @@Ryansacrobat
@Ryansacrobat
@Ryansacrobat 5 лет назад
@@MaikKleinert Thank you for that! I will ;)
@marcushillerstrom25
@marcushillerstrom25 5 лет назад
Do it exaggerated, like pretend that your dropping the camera and it just floats away and then back to you or something.
@veganlifechange
@veganlifechange 4 года назад
But they probably enjoyed your video more all the same!
@JasmineJ-SuDirector
@JasmineJ-SuDirector 5 лет назад
In the middle of writing a treatment, Mr. McKinnon blesses us with CONTENT!!! ❤️
@Kunafah
@Kunafah 5 лет назад
Thank you for the very kind demonstration Peter! Loved it
@derkholme
@derkholme 5 лет назад
So what you're telling me is.. I need my own personal camera guy??
@ExploredPerpsective
@ExploredPerpsective 5 лет назад
That's what I took from this!
@Hashoshi4
@Hashoshi4 5 лет назад
You know what I suspect....? another 8 minutes and 30 seconds of my life well spent watching Pete's content... yup. Inspiring my content FOR SURE
@n.s.hproduction9548
@n.s.hproduction9548 5 лет назад
Dude! I didn't even notice the tricks at the first time! Awesome! Keep it up!
@olvisible6771
@olvisible6771 5 лет назад
I really like your vibe man! Keep doing what's kickin' up your mind!
@Ropetupa
@Ropetupa 5 лет назад
I thought that this effect will be easier to achieve when you have a drone. I wish I would have known that was BAD idea before I lost my index finger.
@danzbeard
@danzbeard 5 лет назад
Come on man!!! Timmy's is legit!!! Double double, can't go wrong.
@AndrewCrossley
@AndrewCrossley 5 лет назад
Awesome video, loved these tips and tricks 👏
@armstrongphotography21
@armstrongphotography21 5 лет назад
What a fun Video now I will be looking for this cool camera moves in the future. Thanks Peter.
Далее
TOURIST VS PRO PHOTOGRAPHER
14:16
Просмотров 2 млн
5 Useful In Camera Tricks
8:17
Просмотров 297 тыс.
POLI зовет Газана
00:12
Просмотров 217 тыс.
НУБ ИЩЕТ ЖЕНУ В GTA SAMP
22:34
Просмотров 269 тыс.
CAMERA BASICS 3
15:07
Просмотров 908 тыс.
42 FUN ACTION CAMERA SHOTS
12:42
Просмотров 1,6 млн
GOOD STORY WINS. ALWAYS.
18:45
Просмотров 875 тыс.
NIGHT PHOTOGRAPHY
11:26
Просмотров 4,8 млн
The Secret to getting THE BEST shots!!
35:47
Просмотров 1 млн
Camera Magic Tricks & Transitions that ANYONE can do
14:25
Shoot Like a Cinematographer, Not a Videographer
11:44
Просмотров 863 тыс.
URBAN PHOTOGRAPHY
15:42
Просмотров 1,5 млн
POLI зовет Газана
00:12
Просмотров 217 тыс.