Тёмный

Hockolicious - The History of Trackmania's Most Hunted Track 

Wirtual
Подписаться 1,1 млн
Просмотров 1,6 млн
50% 1

Given 15 years of competition, how far can the best Trackmania players push the record on a track with just 10 turns? The answer is always juuuust a little further.
Support the channel on Patreon and get early access to new videos, as well as your name listed in the credits. It's much appreciated:
/ wirtual
Check out my livestreams:
/ wirtual
Music List
bit.ly/WirtualMusicList
Edited by Ryxsar
/ ryxsar_

Игры

Опубликовано:

 

25 май 2023

Поделиться:

Ссылка:

Скачать:

Готовим ссылку...

Добавить в:

Мой плейлист
Посмотреть позже
Комментарии : 2,7 тыс.   
@sweatycommenter
@sweatycommenter 11 месяцев назад
I'm glad Wirtual still uses his second channel
@HammMann
@HammMann 11 месяцев назад
KEKW
@happygamer787
@happygamer787 11 месяцев назад
Yeah finally
@D0qy
@D0qy 11 месяцев назад
Yeah
@DoomGuy148.
@DoomGuy148. 11 месяцев назад
At least we can expect a video once a year so that's good.
@penguinoverlord9994
@penguinoverlord9994 11 месяцев назад
LMAO YES
@irgendeinnamee12
@irgendeinnamee12 11 месяцев назад
Can we appreciate the fact that racehans literally plays a role in nearly every of wirtuals videos? Truly one of thr greatest in my opinion
@graham1034
@graham1034 11 месяцев назад
He is kind of Wirtual's nemesis at this point.
@mrsillytacos
@mrsillytacos 11 месяцев назад
Nah Hefest 💀
@ProgramKiraTV
@ProgramKiraTV 11 месяцев назад
There’s a lot in the folder
@SilentKillerPrince
@SilentKillerPrince 11 месяцев назад
I mean there aren't that many top players in the whole game
@Zooz.
@Zooz. 11 месяцев назад
there aren't many top players crazy enough to do so much record hunting rather than league play
@Senbaek
@Senbaek 11 месяцев назад
What I learned about Trackmania watching Wirtual: every single map ever is Trackmania's most hunted track.
@anonymous7704
@anonymous7704 11 месяцев назад
No there are much more hunted tracks than this xdd
@Senbaek
@Senbaek 11 месяцев назад
@@anonymous7704 My point exactly :p
@DeeDee-qb7ok
@DeeDee-qb7ok 11 месяцев назад
At the time.......... He literally tells you the time frames
@N3onDr1v3
@N3onDr1v3 10 месяцев назад
Its always the most hunted track somewhere...
@cameronfenkarek
@cameronfenkarek 10 месяцев назад
@@anonymous7704A-1
@tomow7566
@tomow7566 11 месяцев назад
Seeing Karjen crash physically sucked the soul out of my body for a moment
@EEEEEEEE
@EEEEEEEE 11 месяцев назад
E
@hussystark8742
@hussystark8742 11 месяцев назад
E
@dozergaming69420
@dozergaming69420 10 месяцев назад
Same bro. I gasped and dropped my phone
@asaknight-richard3959
@asaknight-richard3959 10 месяцев назад
Ayo but same
@DeadEye364
@DeadEye364 10 месяцев назад
I shouted Noooooo!
@cd-zw2tt
@cd-zw2tt 11 месяцев назад
seeing Karjen's god run fail was so heartbreaking
@Joe-po8rx
@Joe-po8rx 11 месяцев назад
I audibly gasped
@adamsjoberrg
@adamsjoberrg 11 месяцев назад
I still feel physically ill when I see it, I can't imagine how he feels about it.
@ivangenov6782
@ivangenov6782 11 месяцев назад
Ngl, im kinda surprised he didnt yeet his setup through the window, cause I would have
@modzindotmp5
@modzindotmp5 11 месяцев назад
being karjen after so many years of heartbreaking fails, he's probably damn used to it 💀💀💀
@darklorty
@darklorty 11 месяцев назад
Pulled a wirtual right there
@willemblom8554
@willemblom8554 11 месяцев назад
I remember my grandkids telling me about this youtube channel, I feel so grateful that he has returned
@Poincianaa
@Poincianaa 11 месяцев назад
we're happy to have you Willem
@liamsalton
@liamsalton 11 месяцев назад
It's sad though cause now he has a total of 70 videos not 69 😢
@Tyuf_
@Tyuf_ 11 месяцев назад
@@liamsalton new objective: 420
@crackedtadacktle1003
@crackedtadacktle1003 11 месяцев назад
subto his secondary account he uploads a lot on there :)
@amp4105
@amp4105 11 месяцев назад
900 likes for this anti humour
@monkai666
@monkai666 11 месяцев назад
The first Raizo run looked like a fight, the 50.0 looked like a dance.
@tppolo009
@tppolo009 11 месяцев назад
an absolute cracked shortcut run. perfect bug checkpoint flyby, multiple great wall climbs, and the low air time in the middle of the map was insane.
@552jacki3
@552jacki3 11 месяцев назад
LMAO
@ghomerhust
@ghomerhust 11 месяцев назад
@@tppolo009 when it comes down to it, the technical drivers should appreciate the precision he had in that run. yeah fast lines and pixel perfect is a thing, but you have to use that same level of skill when doing those stunt runs as well. you need to bounce the car just right, you need to bump that wall perfectly in the right spot and angle. it's ALL technical precision, just different directions. its like rallye vs F1. both are at the extremes of automotive insanity, but both are equally perfect
@EEEEEEEE
@EEEEEEEE 11 месяцев назад
‎‎‎‎‎E
@552jacki3
@552jacki3 11 месяцев назад
@@EEEEEEEE A
@KarjeNtm
@KarjeNtm 11 месяцев назад
I was hoping you would make a video about this map one day, and I have to say you covered its history very well. Was a pleasure to watch! 13:13 is still one of the most painful moments of my life. Before this, I hadn’t really fully committed to the map, but this time I was really going for it. I was going for that “knockout” run as you perfectly described in the video; and this was the run. I remember seeing -0.17 on my current PB in the checkpoint after the poles, and after that my vision started to fade. My body could not handle it. I think it meant a little too much for me at the time. Next thing I know I have crashed on a spot I had never crashed on before. Then I just find myself sitting on my bed, dying a little bit inside, refusing to believe what had just happened. With that said, I can’t stretch enough how strong Tasty’s run is. Truly an amazing achievement and I’m so happy we got to see a 53.7x in the end :)
@posh1328
@posh1328 11 месяцев назад
I felt a little heartbroken watching that part and I wasn't even the one playing, can't imagine how it felt for u :(
@pikipxx
@pikipxx 11 месяцев назад
you are the goat
@hf91cod91
@hf91cod91 11 месяцев назад
Legend
@paulgodot4248
@paulgodot4248 11 месяцев назад
GOAT ❤
@jagw4832
@jagw4832 11 месяцев назад
Bro I don't even play the game, and I audibly gasped when it happened. That's just brutal.
@karl2883
@karl2883 11 месяцев назад
Damn your upload schedule is as consistent as your COTD division
@bartek117
@bartek117 11 месяцев назад
💀
@D0qy
@D0qy 11 месяцев назад
it’s been 7 months finally a upload 🤣🤣
@D0qy
@D0qy 11 месяцев назад
I understand 1 month uploads but half a year uploads…😁
@brandonm1708
@brandonm1708 11 месяцев назад
@@D0qyhe made a community post saying he lost his password Edit: nvm that was a joke I guess
@bluecreap463
@bluecreap463 11 месяцев назад
@@brandonm1708 ? lost his password for 7 months, kinda doubt that, id guess its just way too much work when he can go live on twitch and get way more money than he already needs
@ERROR-rx5co
@ERROR-rx5co 11 месяцев назад
I’m happy there’s a video out, but after finishing it, I don’t think I’m ready for another half a year of nothing 😢
@SkylineLofe
@SkylineLofe 11 месяцев назад
i raise you WirtualTV or his twitch steams
@fish.come.from_the_milk
@fish.come.from_the_milk 11 месяцев назад
He lost his password
@buoy7598
@buoy7598 11 месяцев назад
@@SkylineLofe I think we all know those just don’t quite hit the same
@natenbezonb397
@natenbezonb397 11 месяцев назад
He just Lost his password that's why je wasn't uploadint
@s3m527
@s3m527 11 месяцев назад
@@SkylineLofe What is WirtualTV?
@God-xd1wr
@God-xd1wr 8 месяцев назад
I love when Wirtual says that a run is “nearly perfect” and I can see there’s still most of the video left.
@philipmorse-fortier5499
@philipmorse-fortier5499 7 месяцев назад
The slowdown on Karjen's run when he drifts soooo close to the second pillar is fantastic editing detail. Cheers!
@Dave.734
@Dave.734 11 месяцев назад
wirtual probably has more words said about pyramids on WirtualTV than generally on his whole main channel
@pietrocorsini7123
@pietrocorsini7123 11 месяцев назад
"ok but guys did you know the pyramids couldn't have been built by piling the stones one on top of the other by using a ramp going around the pyramid because of the calculations needed to build a symmetrically optimised pyramid??? It's obvious this type of ramp wasn't an option that's why it's much more likely that green little aliens came on Earth 3000 years ago to build the pyramids and then left without saying a word" -Wirtual in at least half of his streams
@arn2556
@arn2556 11 месяцев назад
Fun fact: frostbeule was also a very good mario kart time trialer, holding world records in several games. One of his most notable accomplishments was getting the first 1:09 on Luigi Circuit within the first 2 weeks of Mario Kart Wii’s release!
@poppypug2592
@poppypug2592 11 месяцев назад
Thought his name rang a bell
@doctorjawline7608
@doctorjawline7608 11 месяцев назад
@@poppypug2592 DANG!
@yourlocalraccoondealer8611
@yourlocalraccoondealer8611 11 месяцев назад
The production value of these videos is something i don't see people talking about enough. These are beautifully made and edited to perfection. Spectacular work Wirtual
@RC.13
@RC.13 11 месяцев назад
Agreed, especially the shot at 2:44
@G4Cidib
@G4Cidib 11 месяцев назад
God I love that line... "And then... he got this run on XXX." Something epic always follows. Love the content, the crew(props editors WOP WOP) and the attitude. Very wholesome, keep it up. I wish health upon you brother!
@wombat4191
@wombat4191 11 месяцев назад
"He finally achieved what everyone had hoped to see one day. Hockolicious pushed to the human limit." Looks at video run time. 12 minutes left.
@shirothefish9688
@shirothefish9688 11 месяцев назад
I was waiting for "or was it?"
@LordChaosHavik
@LordChaosHavik 11 месяцев назад
I was waiting for Hfest to be the next words out of his mouth
@au1317
@au1317 11 месяцев назад
To be fair, the cut runs only started because of TAS
@ahole5407
@ahole5407 11 месяцев назад
Human limit?? These idiots used computers to tell them how to do things because they have zero talent themselves. These are the same idiots that use aimbots and wall hacks in COD just so they can post videos and make money. Players like this are trash and should be banned.
@MarsJenkar
@MarsJenkar 7 месяцев назад
"Hockolicious pushed to the human limit. ...At least, the normal way."
@pedrocarvalho6609
@pedrocarvalho6609 11 месяцев назад
The time off really improved on Wirtual's video quality related to previous criticisms. This time he actually showed a whole run through in the beginning. The math tho KEKW, 700/500000 is 0.0014 or 0.14% , not 0.0014%. Great video as per usual!
@sboss
@sboss 11 месяцев назад
Damn, beat me to it lol
@mzdrhffgh
@mzdrhffgh 11 месяцев назад
Wirt is known for his horrible math and percentages in his videos LMAO
@ayooobro
@ayooobro 11 месяцев назад
funnily enough wirt made that exact error in a previous video, writing the decimal answer with a % sign rather than multiplying by 100 first
@reiop6der
@reiop6der 11 месяцев назад
This must have been intentional, he has explained how the mistakes like these (he made one a while back, don't remember a video exactly) get people triggered and therefore, more watches, more comments, more discussion and in the end - more money :)
@pedrocarvalho6609
@pedrocarvalho6609 11 месяцев назад
i remember him being bad at it, i don't remember it being on purpose, if so that's a power move and i respect it lmao
@corey1845
@corey1845 11 месяцев назад
The way wirtual narrates this is just perfect. Pure focus on the runs. Straight forward plus Storytelling. A pleasure to watch for true long term TM fans
@RubyPiec
@RubyPiec 9 месяцев назад
And newbies alike!
@iaderesel
@iaderesel 9 месяцев назад
Cool narration! I have to say I'm on the side of those who would like the shortcut-WRs to be listed separately. What makes Trackmania even interesting in the first place (to many) is its amazing flow. Those shortcut runs by contrast are as unflowy as it gets
@tomohawk2177
@tomohawk2177 11 месяцев назад
When we needed him most, he decided to wait a few months then come back
@mattpatt4976
@mattpatt4976 11 месяцев назад
he has another channel yk, this is his second channel
@aterrariastarcell5952
@aterrariastarcell5952 11 месяцев назад
@@mattpatt4976 at this point, this channel is his 2nd channel
@EEEEEEEE
@EEEEEEEE 11 месяцев назад
‎‎‎‎‎‎‎‎‎E
@user-qd2dx9wf4k
@user-qd2dx9wf4k 11 месяцев назад
13:16 I can't even imagine that feelings. What a hardbreaking moment for just a human.
@user-qd2dx9wf4k
@user-qd2dx9wf4k 11 месяцев назад
@IonRuby Haha😅 I'll just leave it like this)
@tefhypr
@tefhypr 11 месяцев назад
@IonRuby no-one cares if someone has bad english. maybe its not his main language.
@wroomwroomboy123
@wroomwroomboy123 11 месяцев назад
@IonRuby it sure as hell wasn't softbreaking
@dmitryburlakov6920
@dmitryburlakov6920 11 месяцев назад
⁠​⁠@IonRuby habibi 💀 abi 💀 there are 8 (八) billion (कोटि कोटि) people (ხალხი) on this planet 💀 that speak hundreds of languages you don’t even know about and English is not even the biggest, 兄弟. Respect my чувак for his wish to write in the language you understand.
@EEEEEEEE
@EEEEEEEE 11 месяцев назад
E‎‎‎‎‎‎‎‎‎‎‎‎‎‎
@Stogdad17
@Stogdad17 9 месяцев назад
My guy, you are such a captivating storyteller it is unreal. I haven’t played TM in years, and here I am watching 30min long videos back-to-back because it feels like I’m watching a professional documentary.
@lvlurarti
@lvlurarti 10 месяцев назад
I got so many goosebumps throughout the video, the hype just keeps adding up. I think this is your best documentary yet. Amazing job Wirtual!
@chinmingzhu5764
@chinmingzhu5764 11 месяцев назад
I asked tastyy how much time he spend on hockolicious. He told me it cost him like 1500 hours on this track alone lol. The madman literally sacrificed his life for the wr. Absolute legend. RIP tastyy, spend 1500 hours for wr just for it to get cut.
@adamsjoberrg
@adamsjoberrg 11 месяцев назад
And then someone cut it, lmao.
@tastyy4985
@tastyy4985 11 месяцев назад
lol rip
@Kostchei
@Kostchei 11 месяцев назад
@@tastyy4985 The madman himself!
@THICCTHICCTHICC
@THICCTHICCTHICC 11 месяцев назад
@@tastyy4985 big rip but iconic
@EEEEEEEE
@EEEEEEEE 11 месяцев назад
E‎‎‎‎‎‎‎‎‎‎
@json_bourne3812
@json_bourne3812 11 месяцев назад
I audibly gasped at the ending of that "god run"
@madsmadstm8227
@madsmadstm8227 11 месяцев назад
So did I :O Who would've thought I would get so emotionally invested over a video game I don't even play
@parknich081
@parknich081 11 месяцев назад
​@@madsmadstm8227 bro stfu u ain't original
@utkn
@utkn 11 месяцев назад
I haven't seen that run in a few years and I reacted the same way I did for the first time
@jeefori
@jeefori 11 месяцев назад
I get so nostalgic watching these types of videos, they’re just so well put together, and it really pays off
@ricolorenz7307
@ricolorenz7307 10 месяцев назад
God damn. Wirtual is such a good storyteller. I've never played this game in my life, but I love these history videos. So cool
@supersmellslikefeet
@supersmellslikefeet 11 месяцев назад
It's crazy how consistant his uploads are. Hats off to you Wirtual
@R3bel02
@R3bel02 11 месяцев назад
See you in the next year then!
@DustyyBoi
@DustyyBoi 11 месяцев назад
​@@R3bel022 weeks
@MCGEEE3
@MCGEEE3 11 месяцев назад
Go to his second account
@kalcalous8097
@kalcalous8097 11 месяцев назад
It is always a nice year when wirtual uploads❤
@oncenoised7229
@oncenoised7229 11 месяцев назад
Man everything feels so fluid in this video, the voice, narration, music choices… Crazy good !
@FaizanAli-cj9el
@FaizanAli-cj9el 11 месяцев назад
Wow man where have you been, discovered this channel and watched every single video. It’s like a rollercoaster journey watching every video with the emotions they put you through. Im so glad he’s back for another video, hope to see you again soon , don’t want to wait for as long as i did again lol. I love this channel 😂
@user-kv2ep1yr9g
@user-kv2ep1yr9g 11 месяцев назад
I love how this start with the importance of flow and how all good maps need a good flow just to throw it out the window and end about how the real objective is to go fast as possible, flow be damned.
@EEEEEEEE
@EEEEEEEE 11 месяцев назад
E
@lolShoulder
@lolShoulder 11 месяцев назад
"When he got this run" - Wirtual. What an amazing quote!
@patrickwebster9153
@patrickwebster9153 11 месяцев назад
I was wondering when it would happen, made us wait like 15 minutes 😂. I like the original “this run” music better though.
@kyocommittee5630
@kyocommittee5630 11 месяцев назад
I missed this style of videos from Wirt, but nice to see he hasn't forgotten about them. Love the content
@RainbowDark
@RainbowDark 11 месяцев назад
Wirtual this is a work of art! What a wonderful video, I loved the music choice for this episode. And all throughout, narration and editing were insane. All the visuals of the racelines and the runs transitioning one into another when fast forwarding a few years. Really amazing. Also one of the greatest things in my opinion is that you give it time to breathe, there's cinematic parts that have no narration and just.. flow I'm really looking forward to the future videos coming to this channel !
@armsofundertow98
@armsofundertow98 11 месяцев назад
I understand the goal is to go as fast as possible in trackmania but theres just something so much more impressive about Tastys record than the cut way to me.
@Harrock
@Harrock 11 месяцев назад
Yea I would rather watch a slower run that has a nice flow , pixel perfect corners than someone crawling over barriers and clipping through floor 😂😂😂 . They should make the order in wich the checkpoints get approached fixed
@jethroortega4129
@jethroortega4129 11 месяцев назад
Most major speedrunning communities have separate leaderboards for glitched and glitchless runs. I feel Trackmania Exchange would benefit from separating the leaderboads much the same way. I don't know much about Trackmania other than what Wirtual uploads (and I played the recent console release for a few hours), but it's clear that the track loses something when it's cut the way it has been here. Tech players who aren't interested in cutting the track are completely left behind, and being erased from the history books, by the people gladly doing so. And FWO waiting (or trying to anyway) to reveal that they cut the track until they got most of the top spots on the leaderboards is a very toxic way to go about it, in my opinion. Like giving a middle finger to every tech player. Not saying that cutting the track doesn't require player skill, but there's a great deal more luck involved. So the leaderboards should reflect that, since not everyone is on an equal playing field.
@RC.13
@RC.13 11 месяцев назад
@@jethroortega4129 why do you think shortcuts don’t require as much skill?
@jethroortega4129
@jethroortega4129 11 месяцев назад
@Rob Clifford clipping through the track, which is done here, requires luck. Therefore, not as much player skill is involved since the clip isn't always consistent. Shortcutting the track does require skill, I'm not trying to argue that it doesn't, but shortcut runs should have its own leaderboard separate from those who drive the track 'regularly'. Like I said, there's different categories in most speedrunning communities depending on how the game is run and of course a glitched run (which this is the rough equivalent of) is going to be faster than a glitchless run. With separate leaderboards, tech players can still chase the WR with other tech players instead of unilaterally being forced off the top of the leaderboards, and shortcut players can still find ways to break the track. Both communities win in the end, and you keep competition alive in two different racing styles rather than just one.
@ChristofferFlensburg
@ChristofferFlensburg 11 месяцев назад
@@jethroortega4129 Also not knowing anything about trackmanaia apart from wirtuals channel, it seems tech or cuts are both pushed to the limit in terms of skill. As in, the skill/luck in a pixel perfect cut is not that different in the skill/luck in a pixel perfect race line? Both require a highly skilled player to try it over and over for many hours to make everything come together. Idk, I find both impressive and entertaining to watch, so I agree that it sucks for tech players that they get erased from the top of the leaderboard when a cut is found.
@Eyohna
@Eyohna 11 месяцев назад
This is the kind of map where the no cut wr will always be 500 times more impressive
@WillemTM
@WillemTM 11 месяцев назад
Real and true
@Trep3
@Trep3 11 месяцев назад
until the cut is also grinded and perfected for 15 years Chatting
@McLennox
@McLennox 11 месяцев назад
I can't disagree more. The cut wr has to string together a handful of difficult tricks while maintaining momentum. The massive gap between the 1st and 2nd time are a testament to the new skill ceiling. How many people were within a tenth, or even a hundredth of the old way? Now we have a clear winner, who decimated the rest of the competition with arguably the most technical way of driving. It's about tech after all, isn't it?
@HoLLyWoOdUnDeAdFaN96
@HoLLyWoOdUnDeAdFaN96 11 месяцев назад
I personally admire the cut WR more, all the ingenuity of finding the ideal path with AI technology, trying it out with TAS, then practicing it, and finally managing a good run with all the insane tricks required, is such an impressive task. I'm not saying the no cut WR wasn't impressive, it was damn near the human limit, which is exactly why the cut was found.
@ivanjermakov
@ivanjermakov 11 месяцев назад
I feel that no cut wr is more impressive because of how little luck it involves.
@PoetryStud
@PoetryStud 11 месяцев назад
Videos like this telling stories of perseverance mean so much to me. I'm sitting here at GDQ watching this video and I wouldn't be able to be here without the inspiration from great runners of all sorts of games, and from videos like these. Thank you so much Wirtual for the inspiration you provide!
@jordiattencia4948
@jordiattencia4948 11 месяцев назад
Glad to see you back with an amazing video. Looking forward to the next one!
@jackvandenberg273
@jackvandenberg273 11 месяцев назад
Congrats on 1 mil! 🎉
@Oscwal
@Oscwal 11 месяцев назад
He hit that a long time ago
@DustyyBoi
@DustyyBoi 11 месяцев назад
​@@Oscwalhard to keep track when you haven't visited the channel in 7 months
@RuhaanT
@RuhaanT 11 месяцев назад
Your storytelling skills are impeccable. Huge respect , the skill to retain and entertain a massive viewer base is not something everyone can do
@SpacePizza2006
@SpacePizza2006 10 месяцев назад
The return. Thanks for making another video here. I finally started playing TM myself and was wondering where you had gone.
@thepandorus
@thepandorus 11 месяцев назад
The most beautiful thing about wirtuals channel is like.. just imagine how many cool stories about trackmania is out there, and even I don't playing that much of that game I can really appreciate the dedication players had and have to beating records and building legends among the community. Very well done guys, that was amazing
@klausbaudelaire5754
@klausbaudelaire5754 11 месяцев назад
The editing in this was spectacular. Specifically, the zoom-in to the drift around the pole at 10:13 astounded me, and gave me a more profound appreciation for the difficulty of the run. Wonderful documentary all around!
@RainbowDark
@RainbowDark 11 месяцев назад
yeah, I loved that there was no words as well, just a visual explanation
@LeWi100
@LeWi100 11 месяцев назад
This track was the first tech map i ever played, good memories. The best thing is that i actually almost instantly thought about a cut where you overwall the first turn, similar to how it was eventually done. I was really hyped when i saw a cut being performed, even though it also makes me sad, because the insanely clean no cut runs are not at the top spot that they deserve anymore
@psyched91
@psyched91 11 месяцев назад
This video gets me so damn nostalgic I'm almost getting sad >
@rogersbackhand
@rogersbackhand 11 месяцев назад
So happy to see you back on the main channel !! Another wonderful story, thank you :)
@StronkFishy
@StronkFishy 11 месяцев назад
the tension on every run is so high it keeps my confidence up on my own Trackmania runs. Keep up the good work Wirtual!
@tailselrayo7847
@tailselrayo7847 11 месяцев назад
Dude, I discovered your chanel around 2020, when the new game released and I binged all your documentaries since then, but imo this video is your best one yet. The map, the players, the clash between cut and non cut history and the way you told that cooked up I think the most beautiful and complete representation of the game's community you could ever do. Incredible work !
@yannikrielp2380
@yannikrielp2380 11 месяцев назад
Hey Wirtual, I just wanted to point out a serious math mistake at 5:27 . It should be 0.14% instead of 0.0014%. You might have forgotten to multiply the result by 100 to get the percentage number after calculating it
@kylian8295
@kylian8295 11 месяцев назад
No one really care
@GnuSnu
@GnuSnu 11 месяцев назад
Bro he's done the math correctly you should go back to school
@qrow356
@qrow356 11 месяцев назад
@@GnuSnu you should probably look a little bit closer at the calculation
@Elantien
@Elantien 11 месяцев назад
​@@kylian8295 chut up then
@Elantien
@Elantien 11 месяцев назад
Funnily enough maybe this is an intentional mistake ^^
@MitehMusic
@MitehMusic 11 месяцев назад
I've never played a single second of this game and never watched it nor am I familiar with any of the history, but I love the videos on this channel. You have a super relaxing voice and I find the depth of the competition and drama behind these videos amazing.
@jjpswfc
@jjpswfc 10 месяцев назад
In a video I watched on his second channel the other day there was something on screen that said "hello to people that like to go to sleep to these videos" lmao
@frozenwings3605
@frozenwings3605 7 месяцев назад
I have not played a single minute of Trackmania in my life but my god I love your videos about this game. I actually love watching these videos. Thank you so much for the content you make.
@chompo9135
@chompo9135 11 месяцев назад
Yo Raizo's run was so smooth it looked like a TAS. Insane
@XionSteel
@XionSteel 11 месяцев назад
A track that is both tough to play normally and tough to cut. Both are equally needed in skill and both are impressive in their own right. This track deserves it's place as one of the best.
@ZahaX
@ZahaX 10 месяцев назад
I love your story telling and work on those videos!! Really entertaining 🔥🔥
@johnjable33
@johnjable33 11 месяцев назад
Things I know about track mania 1. Cars go vroom 2. Wirtual makes videos about it 3. I’m inexplicably going to watch every damn one
@Stew2122
@Stew2122 11 месяцев назад
These are the coolest videos to watch imho. To watch as you detail the history of the world record hunt on a map is enticing. You and your editors keep being awesome! ❤
@apsis963
@apsis963 11 месяцев назад
Out of curiosity, does anyone know if Frostbeule is the same person as the one who drove a WR in Mario Kart Wii during 2008?
@Wirtual
@Wirtual 11 месяцев назад
Same guy! He also set several world records in F-Zero. Overall just incredible skill in several racing games
@apsis963
@apsis963 11 месяцев назад
Ahh cool, thank you. (Wasn’t expecting a reply from you!)
@EEEEEEEE
@EEEEEEEE 11 месяцев назад
E
@juliusfaller5585
@juliusfaller5585 11 месяцев назад
I know you make high quality videos because every single video of yours is truly gripping to me and I have never played trackmania in my life nor been interested in it until now
@Pixxldude
@Pixxldude 11 месяцев назад
Before i start watching: I am so damn lucky that you made videos on this channel again. I also enjoy sometimes watching you on twitch. But THIS is pure master class, i just love this type of videos. Thanks that you dont "forget" them :)
@AwJack
@AwJack 11 месяцев назад
He remembered his main channel password! Haven't gotten through the whole video yet, but I anticipate amazing work thought the entire video like we've come to expect.
@Hossdelux
@Hossdelux 11 месяцев назад
What got me into TM years ago was E02 cuts and how insane they were from all aspects, and I'm happy to learn about this tracks full history and how amazing it is from a tech players pov and from FWOs later. Both incredible in their own ways.
@spowell2665
@spowell2665 11 месяцев назад
it is amazing, how for someone who doesn't play the game, you can make the gameplay so relevant ... so well done... great work.
@catcatcatcatcatcatcatcatcatca
@catcatcatcatcatcatcatcatcatca 11 месяцев назад
When Wirtual said making main channel videos takes a lot of effort I didn’t realise he meant solving an NP-hard computational problem in order to cut the most prestigious map of the classic leaderboard.
@Tapazi
@Tapazi 11 месяцев назад
Always a good time watching Wirtual content
@sebbe2299
@sebbe2299 11 месяцев назад
I will always love and respect KarjeN for what he did. Crazy times
@producedagains808
@producedagains808 11 месяцев назад
This was such a cool battle for the record. Great job at presenting it.
@Shumoku438
@Shumoku438 11 месяцев назад
The Fire Emblem track coming in at 19:20 totally threw me for a loop lol. Good music choice!
@Chizypuff
@Chizypuff 11 месяцев назад
When you mentioned the double pillars being Hock's thing, I immediately thought of winter 21- didn't realize the whole map was a tribute/remake
@luci1st43
@luci1st43 11 месяцев назад
The choice to use King's Plan towards the end there was delightful I need to rewatch NGNL now
@Arville27
@Arville27 11 месяцев назад
Wirtual is Weeb in denial.. just embrace it
@TheThinkingOtterr
@TheThinkingOtterr 11 месяцев назад
I really miss the old ending music. Its emotional, epic and sounds amazing which would add to the watch experience immensly. I just rewatched D07-Race video and that video is special. Not only because the song, but the way you edited and presented the video as a whole felt smooth and well laid out. I also liked the music choice in the middle of the video. The camera panning around the level from different angles while you explain details was great. Legit crying at the end of the video, love it so much
@tppolo009
@tppolo009 11 месяцев назад
I love a lot of the smaller details that condense information as to not make this 30 minute video into 45-60 minutes. Editing tech at its finest. Great video once again.
@L5GUK
@L5GUK 11 месяцев назад
HOLY SHIT HE REMEMBERED HIS PASSWORD
@curcodes
@curcodes 11 месяцев назад
The 2 pilars deserve an entire video! They influential all generations of maps after Hockolicious
@non_cinical_.1017
@non_cinical_.1017 11 месяцев назад
Man I love Wirtual so much! His videos are so good and relaxing. I love these history type vids soo much. Ty Wirtual🙂
@JayNicolasHackleman
@JayNicolasHackleman 11 месяцев назад
Fantastic documentary as always. Just wanna go on record: the music you're all vibing too is from Art of Rally - and is all as amazing as the tracks chosen here
@unom8
@unom8 11 месяцев назад
13:10 man that is heartbreaking - that was a breathtaking run.
@mattiasbunn8771
@mattiasbunn8771 7 месяцев назад
I think with most tracks i am not upset about shortcuts but seeing a masterpiece track like this get shortcut made me irrationally angry. Those runs were beautiful
@Vonie2070
@Vonie2070 11 месяцев назад
Thank you for this video its been a while, been waiting for one of these vids for a while now and you havent disappoint
@jogurtterminator2035
@jogurtterminator2035 11 месяцев назад
bro is finally back omg i love your videos man!
@dbzcollector9963
@dbzcollector9963 11 месяцев назад
As someone who’s never heard of this game before finding your channel, I gotta say this games competition is insane. The amount of time these guys spend on a single track chasing the perfect run would have me pulling my hair out lol
@urionandon
@urionandon 11 месяцев назад
we definitely need a separate leaderboard for cutted runs.. Tasty, very nice grind and epic time
@NicholasproclaimerofMessiah
@NicholasproclaimerofMessiah 7 месяцев назад
This really is an exceedingly excellent video game, and I like that it has no evil theming to it. I'm very glad I have discovered your channel. All your videos I've seen are exceedingly well done also. A ton of fun here.
@butitwasmekrach1164
@butitwasmekrach1164 11 месяцев назад
Your soundtrack choice and taste is sublime, good job
@AL-di1fo
@AL-di1fo 11 месяцев назад
The whole time I was waiting for "And then Hefest got THIS run." Was wild not even hearing that legend mentioned for this track
@Grandremone
@Grandremone 11 месяцев назад
Hefest unfortunately cheated as well :(
@kazuya4133
@kazuya4133 11 месяцев назад
@@Grandremone ????????????????????????????
@xvgm24
@xvgm24 10 месяцев назад
Didn't Hefest get outed for cheating?
@N3onDr1v3
@N3onDr1v3 10 месяцев назад
​@@Grandremoneey what??
@lukasz2457
@lukasz2457 11 месяцев назад
15:15. Greetings from 16th place! Such a good memories with this game and specialy this track :)
@nedcurfman3486
@nedcurfman3486 11 месяцев назад
I’m just glad your back. These are some of the most engrossing documentaries on the platform, and nobody does it quite like you.
@Blaze-ub5uw
@Blaze-ub5uw 11 месяцев назад
SO thankful for the music list document!!!
@hydro-learn4480
@hydro-learn4480 11 месяцев назад
That was so nice. I love the shortcut community! Would be nice if you do a history on CarlJr. It's so rare to see someone lasting so long on the top in any E-sport ever
@theksefan011
@theksefan011 11 месяцев назад
Because it depends on the lifespan of the game, for example, in various fighting games (a genre I've follow for years), there are people who have been at the top for 20 years or more.
@parknich081
@parknich081 11 месяцев назад
​@@theksefan011 because fighting games suck
@theksefan011
@theksefan011 11 месяцев назад
@@parknich081 ok its fine if u think that, i like it and that's what matters to me, but if FGs sucks because of that, trackmania sucks too? 🤔
@ZsebtelepHUN
@ZsebtelepHUN 11 месяцев назад
Hockalicious is such a great track, it has that same nice flow backwards too
@devaventus3031
@devaventus3031 11 месяцев назад
i literally checked yesterday for vids and was wondering if wirtual was still around. glad to see another vid
@artempertsovskiy7596
@artempertsovskiy7596 11 месяцев назад
I thought I am used to Wirtuals videos twists, but when the guy with spreadsheet appeared I completely lost it haha. Great job, thx for video
@rflc92
@rflc92 11 месяцев назад
This brings out the feels, man... ESL tracks back then were so goood! I spent so many countless hours practicing every single one of them, damn... Even had a wr for some time back then 😅
@Matty.Hill_87
@Matty.Hill_87 11 месяцев назад
I love your story videos, you have a way of telling these story's that draws me in everytime
@as_bud_ta1_bo_ha
@as_bud_ta1_bo_ha 11 месяцев назад
this was amazing man! thank you for an opportunity to feel this emotions!
@BigBeerBellyBen
@BigBeerBellyBen 11 месяцев назад
I don't even play Trackmania, but this video is so well detailed and easy to follow that it had me engaged the entire time. Love these vids
@NickSharpx
@NickSharpx 11 месяцев назад
Damn, I still remember Frostbeule from his world record on Luigi Circuit in Mario Kart Wii all the way back in 2009, I remember watching his WR over and over back in 2011 when I was 12... Definitely a very TrackMania-style WR for the Wii game
@birbz1033
@birbz1033 11 месяцев назад
I think you kinda misrepresented Tasty's comment, but fun video nonetheless! It's always sick learning about such rich histories on even just a single Trackmania map.
@sarge3253
@sarge3253 11 месяцев назад
I am happy now. Thank you. Love your streams, but these docs are the goat.
@ROspook
@ROspook 11 месяцев назад
The quality of your videos is top notch!
Далее
The History of Trackmania's Most Shortcut Track
35:32
Wallem - Харизма (пародия Beatrise)
00:24
路飞关冰箱怎么关不上#海贼王 #路飞
00:12
Watch this and I will ceiling musty.
0:11
How I Got A Dream World Record in Trackmania
30:17
Training an unbeatable AI in Trackmania
20:41
Просмотров 12 млн
The Story of Trackmania's Most Controversial Map
21:44
I tried 'Impossible' Trackmania Maps from 2008
13:32
Просмотров 721 тыс.
The Fastest Maze-Solving Competition On Earth
25:22
Просмотров 18 млн
The Perfect Mario Speedrun Explained
43:40
Просмотров 809 тыс.
The History of Halo 2 World Records
57:56
Просмотров 2,5 млн
ДА ЧТО Ж ТАКОЕ... | @Ozvu4enoMedoedom
0:24
Stu Mutation gone WRONG☠️ #brawlstars #shorts
0:14