How Did Our Most Famous Ancestor Really Die?

Подписаться 3 млн

Просмотров 376 тыс.

50% 1

The brand new Eons Puzzle! store.dftba.co...
And the 2023 Eons Calendar! www.complexlyc...
Did our most famous fossil ancestor, Lucy, die by falling out of a tall tree? The answer is part of a decades-long debate over how, exactly, our ancestors transitioned from life in the trees to life on the ground.
*****
PBS Member Stations rely on viewers like you. To support your local station, go to to.pbs.org/Dona...
*****
Produced by Complexly for PBS Digital Studios
Super special thanks to the following Patreon patrons for helping make Eons possible:
Michael Roy, John H. Austin, Jr., Kate Huhmann, Alex Hackman, Tyler Adams, Amanda Ward, Stephen Patterson, Mark Foster, Karen Farrell, Trevor Long, Raphael Haase, daniel blankstein, Roberto Adrian Ramirez Flores, Jason Rostoker, Jonathan Rust, Avery Sanford, Mary Tevington, Bart & Elke van Iersel - De Jong, William Craig II, James Dowling-Healey, Irene Wood, Derek Helling, WilCatRhClPPh33, Mark Talbott-Williams, Nomi Alchin, Duane Westhoff, Hillary Ryde-Collins, Yu Mei, 4th_phase, Jayme Coyle, Ben Cooper, Albert Folsom, Oscar Amoros Huguet, Patrick Wells, Matt Parker, Jerrit Erickson, MissyElliottSmith, Stefan Weber, Dan Caffee, Merri Snaidman, Gabriel Cortez, Stephanie Tan, Marcus Lejon, Nick Ryhajlo, Sean Dennis, Betsy Radley, Anthony, Philip Slingerland, John Vanek, Eric Vonk, Jon Monteiro, James Bording, Miles Chaston, Michael McClellan, Jeff Graham, Daisuke Goto, Gregory Kintz, Chandler Bass, Tsee Lee, Robert Hill.
If you'd like to support the channel, head over to / eons and pledge for some cool rewards!
Want to follow Eons elsewhere on the internet?
Facebook - / eonsshow
Twitter - / eonsshow
Instagram - / eonsshow
References: docs.google.co...

Опубликовано:

27 сен 2024

Ссылка:

Скачать:

Готовим ссылку...

Добавить в:

Мой плейлист

Посмотреть позже

Комментарии : 748

@eons 5 месяцев назад

Hey Eons fans! We wanted to clarify something in this video that’s pretty important to the process of science: peer-review. The 2016 study about the damage on Lucy’s bones went through the process of peer-review before it was published in a scientific journal, which means that experts in the field were given the opportunity to evaluate everything from its introduction to its methods, data, and conclusions before it was accepted for publication. Toward the end of the video, we quoted some other paleoanthropologists who disagreed with the authors of the 2016 study and spoke about their disagreements to the press. We want to make sure to clarify that remarks to the press shouldn’t be given the same weight as peer-reviewed scientific literature.

@pd9664 5 месяцев назад

This is why you guys are tye best...no matter how old the video is you guys will make sure to pin updated scientific information!

@tarjei99 Год назад

Since these lived on the savanna, trees would be emergency exits for our ancestors. I would expect that the upper body would reflect that this was useful for a long time.

@lavinleitrim44 Год назад

I was thinking of how some predators put their catch up in trees, so another option could be falling out of a tree but postmortem, she'd already be dead but the bones would still break freshly. I guess depending on how long she was up there probably would affect it, so I'm thinking not long after.

@jeremymullens7167 Год назад

One guy I saw suggested early humans would stone animals to death. Humans are social even early ones. A group of 10-20 hominids throwing stones will deter predators no tree needed. Two things to support this is it dovetails into early tool creation which is just throwing one rock at another rock and making use of the one that broke with an edge. The other is that every little kid I know likes to pick up and throw rocks even as their parents try to deter them. It’s an instinctual behavior because no one is teaching them and parents usually discourages the behavior. Something like that ingrained should stretch pretty far back.

@jennyanydots2389 Год назад

Maybe you should worry about cleaning the skid marks and sea men stains out of your drawers first boy!

@klausvoerman8171 Год назад

@@jennyanydots2389 “sea men”

@portillamail Год назад

Ahhh another ignoramus. Go and read a book.

@xooberant Год назад

A few of our fellow humans still demonstrate truly amazing skills for climbing trees, cliffs and other things.

@jennyanydots2389 Год назад

Bro, that's races. Why do you gotta post stuff like that? Being races ain't cool son. I think you should apologize.

@SadisticSenpai61 Год назад

One of the authors of that paper came to my university in 2017 and gave a couple talks. Basically, he did scaled up the size of Lucy's arm to match human proportions, did a 3D print of it, and took it to sports doctors and surgeons to see what they thought the cause of the fracture was. They all said it was a fall from height. And then one of the surgeons added that he thinks he could fix it. lol I think it's extremely likely that A afarensis likely still climbed trees regularly - whether to reach fruit, escape from predators, or sleep for the night. And given most of their predators in the savanna likely didn't climb trees all that well, sleeping in trees was probably the safest place to kip down for the night - esp if they didn't have fire (and there's no indication that A afarensis used fire). It's very reasonable to think that until the adoption and widespread use of fire, our ancestors likely still retreated to the trees at night if they were available.

@jennyanydots2389 Год назад

Your "university"? You mean the local group daycare for severely mentally handicapped adults? Is that what you really meant to say?

@caitolent Год назад

@@jennyanydots2389 It's time for your meds.

@jennyanydots2389 Год назад

@@caitolent I'm am a med. I am primarily taken anally but can also be ingested orally. If you apologize to me right now I might give you some boy.

@SadisticSenpai61 Год назад

@@speurtighearnamacterik8230 I didn't say she had been treed by a predator. However, we know that A afarensis was often prey for large predators - we've found plenty of examples of them having been killed and eaten by large predators. Was that what happened to Lucy? There's no evidence to indicate that's the case. As for most animals being afraid of humans? What about it? A afarensis wasn't a human. Nor do we have any indication that they hunted other animals. Did they mob predators when in large groups? Most likely. Do we have evidence of that? No, nor are we likely to get evidence of that. That's pure speculation based on modern species' behavior. Today, Chimpanzees will often sleep in trees when they're available. And they're a lot bigger and probably stronger than A afarensis was. I also pointed out that they probably continued to climb trees to pick fruit - which is also something chimps do regularly. As for caves, there doesn't tend to be a lot of caves in open savanna. Just saying. Basically, my point is that there's a lot of reasons Lucy might have been in a tree. The idea that A afarensis was still climbing trees regularly is hardly far-fetched.

@righthandstep5 Год назад

@@jennyanydots2389 wrong comrade

@matthewtaylor4442 Год назад

I just shattered my left proximal humeral head, and broke the shaft as well. Odd timing with this video. I feel bad for Lucy. It's agony. She must've suffered a lot.

@alicecain4851 Год назад

I'm so sorry to hear about your injury Matthew. I hope you heal well and quickly.

@Davey-Boyd Год назад

Get well soon Mathew

@ianchandley Год назад

I dislocated my left shoulder three months ago - I’d rather urinate shards of glass than do it again…

@christiangraf1178 Год назад

Oh i dont think she suffered at all, she probably died on the spot.

@BallyBoy95 Год назад

Sorry to hear it. But Lucy clearly did not die from a fall, it was poor science (actually, it wasn't even Science, it was marketing for publicity).

@TheUltimateBlaziken Год назад

Perhaps Lucy, assuming her species did climb trees, did so to get some fruit; or maybe to try and escape a predator and slipped or potentially even got thrown off

@islandmaster5064 Год назад

You can climb trees to get a look around and get startled and slip, falling to your death

@barrymoore4470 Год назад

Another possibility that occurred to me is that she was carried up a tree by a predator or scavenger, her lifeless body then falling from that height and fracturing. This doesn't seem likely, because there would probably be evidence of such predation preserved in the bones, but I did consider it as another potential explanation.

@islandmaster5064 Год назад

@@barrymoore4470 Following that it is also possible that she fell after being attacked by a predator. In Africa there is an eagle that will attack and eat humans, especially small children and babies unattended. And ancient eagle/hawk could have made her fall from the tree to the ground

@sohopedeco Год назад

@@barrymoore4470 Well, fruit is the best explenation for adults to climb trees today.

@krankarvolund7771 Год назад

@@sohopedeco Fruits and honey, some african people climb trees to harvest honey from beehives ^^

@stanley5745 Год назад

I used to talk about (a replica of) Lucy when I was a museum tour guide, I always like learning more about her

@ratha8799 6 месяцев назад

I haven't finished this video yet, but even know one thing that connects children all over the world is their love for climbing. I could definitely see that children were taught to stay in the trees while parents did work on the ground in order to keep them safe

@sophierobinson2738 Год назад

I wish I had income enough to become a patron and have it be listed “In Memory of Steve”, a man I never knew, but miss.

@seattlegrrlie Год назад

As a child I was a tree dweller. Trees, bridges, houses, playground toys, fences... you name it, I climbed it and sat on top of it. Lucy doesn't need to be full tree dwelling species to fall out of a tree

@jennyanydots2389 Год назад

Was it the down syndrome? Seems like you got yourself a heavy case of it.

@declanharp9633 Год назад

Exactly, i m 25, and i still love climbing trees. It comes very natural to me. I don't think we need to be a full time tree climber species to spend some time on tree.

@Sho_Ishto Год назад

Same here! I would climb trees as high as I could and just sit up there. I’d let ants crawl on me as I tried to become one with nature. 😅

@lloydymk2013 Год назад

I was a "tree dweller". Lol u climbed trees dude that's it.

@n4v33nkum4r7 Год назад

@lloydymk2013 exactly 😂. It's not like they were just "having fun"or anything. When u were dwelling on trees u didn't have to anticipate all the time about getting eaten by an apex predator

@fernplant6816 Год назад

I recently saw Lucy at the Cleveland Museum of Natural History and it was incredible to see the remains of every humans’ ancestor. I highly recommend visiting the museum if you are able to

@alicecain4851 Год назад

Just... Wow!

@_Opal_Miner_ Год назад

That's just a plaster recreation. The fossil is in the National Museum of Ethiopia. It's not even on display there.

@islandsunset Год назад

@@_Opal_Miner_ you sure the British didn't take it to London? Oh, wait it was discovered in the 70's. Had it been discovered in 30's they would have shipped her long before people could come up with a name

@stephanieyee9784 Год назад

It doesn't matter if it was a model of Lucy or not. To be looking at our famous distant relative would be a very cool experience. And quite humbling. Modern humans think they have it tough. Its virtually impossible to imagine how Lucy and her family group lived and the hardships they faced.

@sneeringimperialist6667 Год назад

There's no proof she was a direct ancestor , she could have been a distant cousin.

@thedarkside7508 Год назад

Can we be ABSOLUTELY SURE that rhinos didn't fall out of trees back then? Great episode, I love your summary on this topic. Wish we had a time machine!

@TheDarkLasombra Год назад

Interesting that the scientists couldn't tell the damage happened after fossilization. I would have thought there were big differences between a fresh bone break and a rock breaking.

@ariochiv Год назад

Well, it stays bone for a long time, but your point is taken.

@christopherfeatherley Год назад

You have to remember, when an animal dies, it doesn't get covered in dirt immediately. Decomposition happens, which attracts predators and scavengers, which moves and crush bones; that is why a complete fossil is so rare.

@highfive7689 Год назад

Definitely a mineral fossil break would be different than bone break right?

@allangibson8494 Год назад

Breaks that the organism survived are obvious. Breaks that resulted in death, less so.

@kathyjohnson2043 Год назад

@@highfive7689 not a pro, but that seems to be right

@Merennulli Год назад

I was compelled to give a Phillip J. Fry "I get it!" on the "we still love Lucy" line. They really like giving you the wordplay lines.

@Beryllahawk Год назад

A very interesting hypothesis, it's really too bad that behaviors don't fossilize. So inconvenient, haha! And I still love how Blake can't help but giggle about the silly word-play at the end of each video. It's great.

@jennyanydots2389 Год назад

Maybe we'll find some old video tapes.

@skyefirenails Год назад

I might just be an armchair archaeologist (or paleontologist), but it makes complete common sense to me that a hominid that small as an adult would spend time in trees just from a safety standpoint. There's a lot you can get away from by climbing.

@jeremymullens7167 Год назад

Hominids travel in big groups and quickly learned to throw rocks at things. I don’t think spending time in trees was that necessary. This wasn’t likely a singular animal that lived alone.

@jessi1789 Год назад

@@jeremymullens7167 you’re really motivated to share your opinion on this, I’ve seen about 4 comments so far. Idk about you but if me and 10 of my mates ran into a tiger, I don’t think the go-to would be throwing stones. Humans definitely did get eaten by other animals, we’ve got so much evidence to support that.

@jourdansarpy4935 Год назад

Modern humans still climb trees to reach safety. There are so many reasons for her to have been in a tree that don’t involve regular day to day activities. Maybe there was some delicious fruit in that tree.

@jeremymullens7167 Год назад

@Andrew G This video bugged me a little bit because it didn’t say anything.

@jourdansarpy4935 Год назад

@@dffndjdjd I’m making the comment in response to scientists trying to jump to conclusions about how an ancient human that supposedly walked in the ground could have fallen from a tree. Whether or not Lucy fell from a tree, when shouldn’t assume that ancient humans didn’t climb trees. We climb trees and fall out of them in 2022. I’m pretty sure you can go back every single year in the history of humanity and find at least one person who fell out of a tree. That doesn’t really say anything about human culture or habits. It’s just one of the things we do as clumsy apes.

@jeremymullens7167 Год назад

The title is “How did Lucy live and die?” The conclusion was “we don’t know”. It took me right back to where I started and why I clicked the video. In this case it debunked information it presented and did not add further to the subject. If the title is was more about the debate and less “click baity” I probably wouldn’t have been as annoyed. Sure it presented a debate on the life and death of Lucy. But the debate was the subject of the video not Lucy.

@jeremymullens7167 Год назад

I think what I’ve seen a lot is this: Humans can climb trees therefore Lucy could climb trees. Which makes the whole debate rather silly without more information. What the scientists are trying to know though is did Lucy spend a large part of her life in trees. Which is different. If Lucy falling from a tree had held up, it may have been a starting point. More tree falling injuries could be found or we could use the information to form an hypothesis and look for supporting evidence. The conclusion puts into question the fall but, it’s reasonable to assume ALL human species COULD climb trees. The question becomes how necessary we’re trees to Lucy’s life style?

@maxximumb Год назад

If a predator was chasing me, I'd climb a tree to escape. Especially if I was only little. Would future scientists think I lived in trees, because I fell out of the one I was hiding in?

@luizffortes Год назад

The point is: you could do that, but a zebra could? So, Lucy could climb a tree as you can, and that is important. There are lots of cultures, especially hunter-gatherers, that climbing trees is very important to survival to this day.

@mustyfan1584 Год назад

How efficiently could you scale a tree trunk? That’s the difference- the Australopithecines retained features that would’ve allowed for nimble and efficient climbing. It’s likely that they climbed trees habitually in search of food, as well as for safely. Similar to modern chimpanzees!

@jeremymullens7167 Год назад

Deer hunters spend a lot of time in trees. They even have special tools to make it easier. But, one individual climbing a tree when alone doesn’t really tell much about a social individual. What would you do if a predator approached you and six adult male friends? What would you do if you were attacked by a predator and your wife and child were with you? What happens if you and your six buddies were there and their wives and children too? My guess is in many cases the predator sees too much risk and leaves. There is one more reason predators don’t usually like hunting humans. We punch them in the face and gouge out their eyes. Humans might die but many times can seriously injure a predator with just fingers and fists. How far back were hominids doing that?

@robertt9342 Год назад

@@luizffortes, imagine all the ways people could die and their bodies not recovered, and what kind of conclusions future scientists could come to.

@LeoDomitrix Год назад

Or if you went up the tree to get better fruit? I used to climb until my 30s, no gear, to get the best fruit out of apple trees. So.... I don't live in one, but I sure do climb 'em.

@markw999 Год назад

Honey. Fruit. Predator. There's 100 reasons she might have been in a tree. Doesn't mean she was there all day.

@JanjayTrollface Год назад

Fun even. Many people forget that some species have ALOT of leisure time.

@octipuscrime Год назад

Or she was murdered and pushed off

@markw999 Год назад

@@octipuscrime Just a bit cynical there. LOL. Not unheard of amongst chimps though.

@sidbid1590 Год назад

But everything changed when the fruit nation attacked.

@fajaradi1223 Год назад

But what if she was there all night?

@davitxenko Год назад

Everyone : How did she die? Paleontologists: She monke fliped...

@thomaspatnode7053 Год назад

One way to look at it is, if she died falling from a tree, perhaps she wasn't so well adapted to being in them after all.

@Itried20takennames 6 месяцев назад

Maybe, unless the branch just broke. I used to foster baby squirrels and they were of course incredibly agile on branches, but I once left a loose branch sideways across the top of our deck railing, and teen squirrel jumped on the end without noticing it was not attached to any thing, and both it and the branch fell off the of the deck. It was fine, but showed even squirrels aren’t great at spotting unstable branches,,,,or at least the younger ones aren’t.

@joemedley195 Год назад

Serves her right for treating Charlie Brown and Linus so badly all those years.

@allasperans3984 Год назад

Imagine that Lucy was the weird one who just liked climbing trees when her species didn't really do that and we're trying to judge whether or not they did based on one strange person😂

@MossyMozart Год назад

@Alla Sperans - Or one playful person. Was she after a bird's nest, ripe fruit, a pretty butterfly, playing hide & seek?

@wisewizard-lq3xs 9 месяцев назад

@@MossyMozart Well then that would be very cruel.. It is amazing how she could just be playing freely, but so devastating how that would lead her to her death.. she didn't deserve it

@BethKjos Год назад

Even after decades of reruns, too! We still love Lucy.

@FourtyWinkles Год назад

This video is just in time for my biology lesson on the origin of humans. We just started talking about Lucy. Thanks for the consistently amazing content!

@sirBrouwer Год назад

if you would like some more deep dive. Real Science is running a seperate series fully dedicated on the origin of humans. It might be only on Nebula but if it's for teaching purpose. maybe very interesting.

@jennyanydots2389 Год назад

I didn't know they taught individuals with such heavy down syndrome things like that. I mean, your down syndrome is so heavy shouldn't you be focused on learning more practical things for yourself? To be honest I'm shocked you can read and type words on the computer. It's truly amazing and something you should be very proud of boy.

@krankarvolund7771 Год назад

I think the question "how much time they spend on trees" is more interesting that if they spent time in trees. Humans can climb trees and will spend some time in it, and we've lost all our adaptations to do that, it would be very strange that one of our ancestors who kept some of these adaptations never climbed trees ^^'

@jeremymullens7167 Год назад

We have retained many adaptations for climbing trees. Two that I can think of are grasping hands and forward facing eyes to help with branch distances. Sure our hands don’t have the curved fingers of other tree dwellers but compare human anatomy with dog anatomy. Those tree climbing traits gave us a head start to grasping tools.

@krankarvolund7771 Год назад

@@jeremymullens7167 True, but our grasping hands can be used for a lot more things than just climbing in trees, and cats don't need grasping hands for climbing in trees ^^ As for forward facing eyes, dogs have it too, it's useful for moving in trees, but also for predation, and we use them for predation a lot more ^^

@aperson22222 Год назад

It’s hard to remember sometimes that, when we look at human fossils, we’re looking at the remains of our fellow people, and should treat inquiries into their causes of death with the same respect and gravity that we would the death of a contemporary.

@allisonhomiak2336 Год назад

"We still love Lucy." Blake has some 'splainin' to do for that pun.

@klangg Год назад

Are there any common wear patters on joints of tree climbers that we can compare these fossils to? Also, is there any evidence of cliffs or valleys in the area at the time that animals may have fallen into?

@jennyanydots2389 Год назад

You sound like a races boy!

@artman2oo3 Год назад

I went through a phase when I was a teenager where I climbed a lot of trees with my friend just for the hell of it. I could have fallen and died from some of the really tall ones. I’m probably lucky to be alive lol. Anyway. Lucy could have just been randomly climbing a tree for the hell of it.

@leeleaman8057 Год назад

Thank you for another fantastic video eons!

@larrywoolford8978 Год назад

Personal I’m doubtful Lucy died from falling out of a tree,simply because her remains were so well preserved. If she died from a fall on the African Savana her body would have quickly been consumed by scavengers and her bones scattered . However she died her remains must have been covered very quickly to preserve her skeleton as well as it is -possibly a flash flood or mudslide killed her. This would also account for the broken bones as well.

@damieno3470 Год назад

Finally someone that thinks! Definitely truth in what you say! That's why you cant always believe the storytelling that accompanies some of these finds.

@NormanF62 Год назад

We still sleep in beds elevated off the ground even after we finally left the trees. It’s the one instinct that makes humans feel safe. Sleeping on the ground is a death warrant. Until relatively recently, hominids only spent time on the ground to gather food and scout out their surroundings. At night though, they would retreat to the safety of the trees to be out of the reach of predators. A trait hominids share with chimpanzees and gorillas who split off from them later.

@TragoudistrosMPH Год назад

Why might that be a big deal? One thing to keep in mind is, back then, when Lucy was newly discovered, walking was considered a "modern trait"... people might have been biased against the idea of Lucy being on the ground, but today we're comfortable with the idea of humans and our ancestors climbing trees or being in the ground accordingly.

@ivytarablair Год назад

yaayyy! I love the Eons & podcast episodes on hominin ancestors/offshoots! (i love all the Eons, but somehow these episodes strike a very deep chord with me and I feel resonance with them. The podcast ep on homo naledi moves me so much I've listened to it at least 30 times

@ivytarablair Год назад

also BLOOPERS!!!! :D

@ellenchavez2043 Год назад

I seem to remember a hole in her skull. There was speculation that she was killed by a big cat and hauled into the tree for safe keeping.

@XmarkedSpot Год назад

I just love Hank narrating, especially the way he does it on Journey To The Microcosmos. Hope to hear more from him. Nothing against this presenter, he is formidable, too.

@Melnokina.-. Год назад

I haye his voice.

@huntersparks5710 Год назад

Fascinating! I was hoping you could do a video on the evolution/purpose of sleep sometime, I'm really interested in learning about that topic!

@nebulan Год назад

Always learning more! Loved it

@cas126 Год назад

Imagine you’re one of the first and you still can’t escape your embarrassing moment being talked about millions of years later

@bora_in_music Год назад

Lucy on the tree with diamonds :)

@LarsCaesar Год назад

If true that’s poetry in nature. The oldest ”human” we found is one who fell out of a tree. One who mightve lived if it was still ape (ik we are still apes, don’t get technical on me, im simply a symbolic poet)

@SaiyanHeretic Год назад

Lucy's Fall is the name of my Beatles ska fusion cover band.

@zeroreyortsed3624 Год назад

This is a great example of why I get frustrated with science coverage in the mainstream news. They make headlines with stories that are just a hypothesis, and then report it as fact. Or the same thing with correlative studies. Where the need reports a headline like " scientists discover _____ causes _____." And that's usually not the case. Usually it's just that they discovered a correlation in a small sample size, that warrants more studies, to see if the correlation is actually meaningful.

@MarioPetrinovich Год назад

Thanks for the info, it is very important that people know this.

@Unpainted_Huffhines Год назад

If I had to guess, I'd say bipedalism came first, when we entered the grasslands, then followed quickly by freed up hands for tool use, which started a big brain - better tool - bigger brain cycle. Edit: with tree climbing ability partially retained to escape predators or gather fruit.

@luudest Год назад

0:27 how did the scientists find out from which hight she fell?

@catcatcatcatcatcatcatcatcatca Год назад

I think it’s just an estimation based on some assumptions: if we assume she was in freefall, had normal bone strength, and that the fractures used for this calculation infact were a result of the fall, we can calculate an estimated energy needed to break those bones. And if you know a needed enegy and a mass of an object, you can calculate how long it takes in seconds to reach that energy in freefall. And then you can convert that time to distance of the fall. That said, there are a lot of variables and assumptions hidden in a statement like that. The scientist only know the force of the impact if we assume their modelling is correct.

@bobjohnbowles Год назад

By making some educated guesses about how big a fall would make that much damage. But as the vid points out, there are other possibilities why the bones are broken, so the idea she fell at all is still up in the air (sic).

@luudest Год назад

@@catcatcatcatcatcatcatcatcatca thanks

@frightstories1474 Год назад

Nobody: Lucy: *sing with me, sing for the year*

@cyankirkpatrick5194 Год назад

John Lennon was inspired by his son Julian to write the song Lucy from a drawing, about his playmate from school.

@Gildedmuse Год назад

Well, that a whole lot of drugs.

@CarFreeSegnitz Год назад

*L*ucy in the *S*ky with *D*iamonds

@cyankirkpatrick5194 Год назад

That's the urban legend story

@OorahhColeman Год назад

I thought he was talking about LSD

@pentalarclikesit822 Год назад

We just keep hearing a "a lot of fractures" and then the ones listed are both hands, both wrists, both arms, a shoulder and the jaw. If it was caused by the effects of fossilization, shouldn't the fractures be essentially evenly distributed in the skeleton? So are there similar fractures in the legs/pelvis/spine, or not?

@jeremymullens7167 Год назад

The bones aren’t an even thickness. Why should we assume forces and pressures happened evenly across the whole fossil? I’m not saying it’s not the case. I’d just like to point out there’s probably a lot going on that might be hard to account for.

@1laurelei1 Год назад

Lol Cher on the battleship was EPIC.

@gyanrahashya6416 Год назад

What...lucy was on someone's property illegally, did she take permission from the owner to climb his tree ? She could have been shot by the owner or dino police of Flintstones could have been called...sheesh

@veggieboyultimate Год назад

Never knew a song would be the name of a fossil.

@wendydomino 10 месяцев назад

I feel like for a tiny hominin like that, it would have been deadly to not be in the trees part of the time. There were so many huge predators and other large animals that could be dangerous that especially without fire technology, it would have been impossible to survive without being able to get up into the trees.

@sauraplay2095 Год назад

Great video guys over at pbs eons!👍

@murkyseb Год назад

That was really interesting great video!

@Trendsetter5420 Год назад

Or maybe this day she climbed the wrong tree…maybe the branch was already about to give out

@composerdoh Год назад

I love how tickled he always gets from the horrible, horrible jokes they make him read.

@vamosaltemacongabrielmende3965 Год назад

What is mesmerizing that no predators, or scavenger dispersed the complete body. Looks like small ones take a bite here-there.

@vladimirlagos2688 Год назад

Everytime I watch one of these stories about the diversity of species and possible lifestyles of our distant ancestors, I can't help but feel a bit lonely and unnerved at the fact that we are the last of the hominid lineage. We will never encounter a different homo species to learn and be wowed anymore. All we will ever have is bones and conjectures.

@OorahhColeman Год назад

I think we bred them out of existence. Some of us still have Neanderthal DNA.

@rocacoshi Год назад

I can just imagina a group of people walking by as they see a tree, and the kids, they want those fruits, and granma auntie Lucy going up, she saw the biggest, ripest, juiciest fruit, and she thought to herself, “let me get those for you guys”, as she was going up she felt the branches get smaller and smaller, weaker and weaker, but she was so close to the fruit, and her family, the kids didn’t just want it, they deserved the best fruit. As she made her way towards it, while on her tippy toes, barely hanging onto the branches, and she can see the fruits, she can almost grab them, if only a breeze would come by they’d be in her hand, but just in that second a loud crack distracted everyone from her hands and the fruit, and everything, everything went, black. Maybe the kids took it to heart, and told themselves “we’ve got to be careful on trees, we can’t go as high as auntie Lucy” and maybe Lucy’s accident just goes to show how we slowly learned that the ground could be safer. Just a theory, just a thought, but giving her a story even if completely made up around her death, just bring in so much humanity that we do often tend to take out of the homo sapiens sapiens humans. They were just like a us, a story that you might hear even today, she slipped and fell while getting the best fruit of the tree for her family.

@Someone-qe6yl Год назад

always love the bloopers/behind the scenes 😆

@Enchantaire Год назад

Maybe it's exactly because of this transition to bipedalism that she fell from the tree. Legs to walk are less adapted to climb trees. It is possible that many of our evolving ancestors caught between the two worlds of bipedalism and living in trees ended up dying from falls, speeding up the transition to bipedalism through natural selection.

@lochness5524 Год назад

Could you do a vid on the differences between Anatomically Modern Humans and archaic Homo sapiens that existed before 200,000 BCE?

@tigris115 Год назад

Tbf, some modern humans can climb trees really well. Can't be too hard to an Australopithecus to climb trees if there was food or if they wanted to escape

@pd9664 5 месяцев назад

Let me add 5 possibilities of how she might of died based off my previous comment. 1 she did fall and some how the breaks in her arms weren't based of of hyenas. 2 she died and was scavenged by aforementioned hyenas. 3 she was stepped on by a massive arthropod. 4 she was found later and her body reused by another group...which would also possibly explain the missing bones. 5 her being found at a top level her bones could of been slowly crushed and or degraded over the millions of years....6 some other group could of found her bones interesting in the past millions of years 7 she could of been trying to run from a massive beast and got rammed. If a rhino hit her and she put out her arms it would be consistent with the same breaks....I love studying anthropology but these doctors need to calm down diagnosing stuff......like I said every human has a bais.....even the most educated. Also hominids are extremely cautious...even chimps dont fall out of trees....so what would cause her to climb 50 feet in tge air just to fall out? Either some of the possibilities i mentioned...or she was pushed. Even lucy would be nimble in the trees compared to us. Chimp bonobos gibons orangutans. They dont just fall out of a tree so why lucy?

@BiggieChungulus Год назад

As a rock climber I don't think it's far fetched to assume we never stopped climbing around.

@libertyfp Год назад

One part to always look forward to in these videos are the jokes. Amazing, haha.

@VelkePivo 11 месяцев назад

Wow, I didn’t know PBS was capable of airing a program that didn’t put DEI before content. What a pleasant change.

@thesjkexperience Год назад

When you are that small you would certainly use the safety of trees on a regular basis.

@SobekLOTFC Год назад

This was excellent. I also love Stefan Milos' video about Lucy.

@ariochiv Год назад

Humans today occasionally die falling from trees, but this doesn't mean we're arboreal. I think it could be argued that death by falling is evidence that a species is _not_ well adapted to climbing. How many tree monkeys die from falling out of trees?

@keithfaulkner6319 Год назад

Studies of gibbons, a group of totally arboreal apes from SE Asia, show that ALL gibbons have broken bones from falls. The video showing as this was narrated actually showed a gibbon missing a grab of a branch, taking a fall, and continuing on its way with a broken arm.

@ariochiv 9 месяцев назад

@@keithfaulkner6319 Breaking bones falling from trees is not the same as dying from falling out of trees. Sorry for the late response, I just happened to be re-watching the video. :D

@keithfaulkner6319 9 месяцев назад

@@ariochiv maybe, but just by odds, some of those many gibbons who fall from trees, basically all gibbons at some point in their lives, actually die from the fall. The lucky ones only break bones. This time.

@secularmonk5176 Год назад

When I saw Hank, I briefly felt the way I did as a toddler when I would grab a strange lady's hand in the store, thinking it was my mom's.

@avenuestx2211 Год назад

You know what's odd, why aren't there any videos on the Great African Riff Valley, it's where we all come from but if you look it up here on RU-vid there's no recent content on this particular area. I would really like to see more about this place, en donde nacimos.

@kostasl1808 Год назад

There is also the possibility that the damage on her skeleton (provided that it was inflicted by a fall) occured post-mortem; a leopard carried the australopithecus high up to a tree and when the predator finished their deep the remainders fell causing the mechanical damage. Of course, one could argue that there would be forensic evidence (teeth/ claw marks) that would steer towards the verification of such a hypothesis but taking into consideration the exposure of the skeleton to the elements and the fact that feline kills tend to be more "skeletally occult" than other animals (they target the throat causing vascular asphyxia) you never know.

@alessandroravagnan9036 Год назад

This is definitely the best existing channel on RU-vid!

@gy2gy246 Год назад

Then you would like "Nova" and "National Geographic" too.

@maxplanck9055 Год назад

Did Callie ghost write these appalling jokes?✌️♥️🇬🇧 Mich love Callie 😀

@OSMRDucksLIB Год назад

Can you make a video about the hallskaraptor and it's relatives

@emmetthowell899 8 месяцев назад

I don’t think Lucy had to live in trees or even spend most of their time in the trees to die by falling out of a tree. Modern humans climb trees just for fun even though our bodies aren’t optimized for it and they have died from falling out of trees or falling from other high places they’ve climbed to. It would’ve been beneficial to move efficiently by walking up right and having the arms for being proficient in the trees especially when in their habitat they would’ve needed to travel pretty far to get resources but trees are the only possible escape from a predator in a savanna. So whether that’s what killed her or not, I think it’s very possible that our ancestors continued climbing in the trees for safety or even to retrieve fruits even after they started walking upright, especially since feet are less important in being able to climb so they could afford to lose the ability to use their feet to climb

@martinahill1752 4 месяца назад

Climber or not, we truly do love Lucy ❤

@juliaconnell 6 месяцев назад

gee - this is tricky - watching (re-watching?) - this as part of 'Survival of the Flops'. first - _this_ is NOT a 'flop' - people are busy = this is awesome content - THIS - vs - the other one - honestly can not decide = both educational, entertaining, fascinating ... (if you want to know more - only a few days left to vote - check out 'community' tab')

@Jean-yn6ef Год назад

💚🏜 I can think of many reasons she was in a tree, fruit, eggs, honey, refuge. I appreciate how eons reiterates how science is an ongoing process of discovery.

@jeremymullens7167 Год назад

All those things are plausible which is their point. No proof is why they gave a variety of reasons. They didn’t write a scientific dissertation. Chimpanzees go in trees for all those things and humans go in trees for all those things. It is certainly reasonable to assume Lucy did as well. The current consensus is that that lineage lead directly to ours. Since it’s not an offshoot that might have lived very differently, I’d say it’d be unreasonable to assume she didn’t do those things.

@daverohrich8518 Год назад

Dang, got excited that Hank might have been doing a guest host

@valentyn.kostiuk Год назад

Fall from tree, said "f this, no more trees!" that is how straight walk and big brains appeared in humans. Sorry, for dark humour, none other left.

@mustyfan1584 Год назад

I think the argument over whether the Australopithecines climbed trees is ridiculous. They retained arboreal adaptations, had arboreal ancestors, and seemed to have eaten a diet of tree based resources. Most likely Lucy used bipedal walking to most efficiently and safely walk between trees and forest patches in their drying environment! And since we have later hominins, even hominins in the genus Homo, who retain some of these features, it’s reasonable to believe that abandoning the trees is a (relatively) recent development.

@mustyfan1584 Год назад

@Brandon Letzco I did too, it’s great! We may have climbed trees for fun, but we don’t have the anatomy to climb a tenth as nimbly as an Australopithecus. They would’ve spent a significant amount of time in the trees foraging for food in a way that we are physically incapable!

@mustyfan1584 Год назад

@Brandon Letzco That being said, I see what you’re saying! Some modern Hunter gatherer cultures still regularly climb trees in pursuit of resources! You could argue our lineage never fully abandoned the trees ☺️

@mustyfan1584 Год назад

@Brandon Letzco I’ll look into that! Sounds interesting.

@mustyfan1584 Год назад

@@dffndjdjd You misunderstand my comment, what I’m arguing against is the idea that the traits are purely vestigial, as some paleo anthropologists believe. I’m actually an anthropology major myself.

@redriver6541 Год назад

Sup Hank. Thanks for the video my guy. I absolutely LOVE everything to do with early Hominids.

@MseeBMe Год назад

Omg it’s Hank!

@mistertravel2442 Год назад

We love Mama Africa 🌍 ❤️

@procrastinator99 Год назад

"Ancient Nosedive" is the name of my new Punk band. lol.

@JeezMrGarnett Год назад

I still am stuck on the hypothesized connection between human evolution/brain complexity accelerating and eating cooked meat. Notice how Australopithecus is found along the African Rift Valley where there would be a lot of opportunities to cook food on volcanic vents...

@MPM6785ChitChat Год назад

For whatever reason still climbing, no matter how dexterous there can still be reasons for a falls - perhaps fighting or escaping from another tree climber like herself.

@ScrapPalletMan Год назад

The "family tree", oh... the puns keep coming

@jilliannoble00 Год назад

That must’ve been a tall tree to break so many bones

@sirlost94 Год назад

One thing i often ponder is: how much knowledge can we infer from one, or even 10 specimens? Some humans have very long fingers, some don’t. If scientists, tens of thousands of years from now, find 10 skeletons of long fingered humans, will they infer humans were better at grabbing stuff than other species?

@nosuchthing8 Год назад

Well a MODERN human might climb into a tree to escape a tiger, etc.

@traceys8196 Год назад

Also almost all kids climb anything taller than them even if most adults don't feel that urge anymore. My grandfather will still climb a tree if one of his great-grandkids are there asking him too though.