Тёмный

The Plans to Assassinate Hitler 

fern
Подписаться 1,8 млн
Просмотров 2,2 млн
0% 0

Visit fern.deals/bri... for 20% off of a premium subscription. Start learning new skills today! It's also a great way to support our channel. (ad)
This is a video about the craziest plans to assassinate Hitler.
Sources: docs.google.co...
Music:
Epidemicsound:
Christoffer Moe Ditlevsen - Enter the Realm of Shadows
Guy Copeland - Ahead of the Game
Christoffer Moe Ditlevsen - Ghosting
Lennon Hutton - Whispers in the Fog
DEX 1200 - Uncharted Territories
Jon Bjork - Slow Revolt
Amber Glow - Pensive Gaze
Artlist:
C.K. Martin - Attack on London
Out of Flux - Surrendered
Tilman Sillescu - There Is No Time
Brianna Tam - Intrepid
Marco Martini - Theater Magnus
Jakub Pietras - Solving the Mystery
Quinten Coblentz - Monster Within
Ardie Son - Fury
Kyle Preston - Eternal Recluse
Naama Zafran - Earth.wav
Lensdistortions:
Inversion (no percussion)
The Music Room:
A Step In The Right Direction - Tom Fox
_____
Armchair documentaries, almost weekly

Опубликовано:

 

5 сен 2024

Поделиться:

Ссылка:

Скачать:

Готовим ссылку...

Добавить в:

Мой плейлист
Посмотреть позже
Комментарии : 2,9 тыс.   
@fern-tv
@fern-tv Месяц назад
The timing of this video might seem a bit weird. Naturally, it is entirely coincidental; we worked on this for months. Enjoy!
@大
@大 Месяц назад
daddy
@JohnCena-rq4bp
@JohnCena-rq4bp Месяц назад
i'm watching this in the bath 👍
@vermillion-sz7vy
@vermillion-sz7vy Месяц назад
props to your animation team on your other works, I assume this will be great
@actuallyalyan
@actuallyalyan Месяц назад
Its ok, trump is no worse than hi!ler
@pyeitme508
@pyeitme508 Месяц назад
Bruh
@4GENS
@4GENS Месяц назад
This is the plots that would make you quit watching a show because it's too "unrealistic"
@kaydens6964
@kaydens6964 Месяц назад
If you think about it, what happened to Trump is pretty a Mr Bean movie.
@kayaphus4303
@kayaphus4303 Месяц назад
Lessons for Trump
@Notell.
@Notell. Месяц назад
​@@BringOutTheLobster.Don't be so jealous. He planned it out and flew a drone 😂 your daddy isn't protected
@markeverhart-xu7hh
@markeverhart-xu7hh Месяц назад
@@BringOutTheLobster.that’s what you think .
@matteframe
@matteframe Месяц назад
when I saw the guy wearing a racoon hat and bull horns in the Senate chambers, I knew the show had jumped the shark
@astral6749
@astral6749 Месяц назад
Resistance: * fails to kill HItler * Hitler: Fine, I'll do it myself.
@Krachbumm-Ente
@Krachbumm-Ente Месяц назад
Imagine believing post war propaganda
@creely123
@creely123 Месяц назад
Argentina actually.
@edvardb.2751
@edvardb.2751 Месяц назад
He had the last card. The death card.
@BGwxlf
@BGwxlf Месяц назад
​@@creely123no he didnt escape dna tests were done on his bones if im not mistaken
@BGwxlf
@BGwxlf Месяц назад
Underrated commemt
@alvin3698
@alvin3698 Месяц назад
Every assassination attempt had a chain of time travelers trying to stop each other from killing or saving Hitler
@mao-tse-tung-games
@mao-tse-tung-games Месяц назад
True man. Butterfly effect: if hitler died, maybe someone more competent might have assumed his place, and the world wouldnt be the same.
@ExtantPerson
@ExtantPerson Месяц назад
@@mao-tse-tung-gamesYep. That’s exactly why the Allies eventually stopped trying to kill him. They realized he was more detrimental to the enemy than beneficial
@EEEEEEEE
@EEEEEEEE Месяц назад
E‎ ‎
@derederekat9051
@derederekat9051 Месяц назад
@@ExtantPerson yup, now they can move uninterrupted destroying Europe thanks to the holocaust blame! Genius move!
@aaronmurray7308
@aaronmurray7308 Месяц назад
That would be a great movie idea
@Emil-y3z
@Emil-y3z Месяц назад
Don`t also forget he was saved from drowning by a priest when he was young and a British solder refused to shoot him in ww1. Mann, he was very lucky.
@SynthiaVan
@SynthiaVan Месяц назад
The 2024 version is "he was protected by god."
@MaddAddam93
@MaddAddam93 Месяц назад
This just affirms that life is chaos and good does not intrinsically succeed more than evil
@martialhero9544
@martialhero9544 Месяц назад
@@SynthiaVanor by the devil
@MoAbuAkb
@MoAbuAkb Месяц назад
No by god ​@@martialhero9544
@TruffoYT
@TruffoYT Месяц назад
Dawg that story isn’t true
@augustus4832
@augustus4832 Месяц назад
"Hitler commited ' ' in his bunker" God, I hate RU-vid's censorship of certain words for historical videos.
@Willy_Tepes
@Willy_Tepes Месяц назад
It is political censorship, but often it affects historical videos.
@SizzleCorndog
@SizzleCorndog Месяц назад
@@Willy_Tepesit’s not even political, they’re just trying to avoid language that would put at risk people on edge
@Willy_Tepes
@Willy_Tepes Месяц назад
@@SizzleCorndog No, it is definitely political. I have been probing and tracking this since 2007. There is a logical reason why you can't see this. You hold no opinions that go against the media narrative. If people knew what was really going on, I am sure some would be very angry..
@SizzleCorndog
@SizzleCorndog Месяц назад
@@Willy_Tepes Thats total bs, in 2007 youtube barely existed and was more interested in showcasing what videos were being actively watched. This was the peak of CoD where people were calling each other slurs or telling them to kill themselves for no reason. Nobody gave a shit back then. The reason they're actually doing this is because there are people who exist that are fighting with whether they should be alive or not and mentioning topics like suicide or self harm might be enough to either send them over the edge or relive some past experiences. This isn't anything new either, people don't like talking about it to the point where back in the day people would say someone "died of grief" or "died of melancholia" instead of just saying they took their own life. The reason you're here moaning and groaning about this is probably because you saw Hitler in the title and thought "finally, more content for me and my Ai Hitler pfp" and then were surprised when they approached the topic with a crumb of sensitivity. But no, its all a narrative created to stop you specifically and keep the rest of us sheeple in line rather than, you know, be respectful of other peoples feelings and experiences.
@cuboidmelon
@cuboidmelon Месяц назад
​@@Willy_Tepes no its not, it's most likely simply the fact that companies don't want to be associated with negative/controversial topics. If youtube didn't censor stuff they wouldn't get money from running ads. Most corporate decisions are made for monetary reasons and not political.
@fbiagentmiyakohoshino8223
@fbiagentmiyakohoshino8223 Месяц назад
40 assassination attempts, and he just kills him self in the end
@psychrubus4503
@psychrubus4503 Месяц назад
lol Fidel Castro had major plot armor too
@bigpapaplantman5126
@bigpapaplantman5126 Месяц назад
I don't believe he killed himself personally. I think he went to Argentina with the rest of his regime. Still to this day, Argentina has villages in the mountains where people speak German, and there have been 1,000's of high ranking nazi medals found in some of the homes. I think the IDF located him and assassinated him some time in the 60's. Just a theory but totally plausible
@memorimusic420
@memorimusic420 Месяц назад
Hitler was like: "if yall cant do it imma do it myself" 😭
@user-pf9rf3sr1q
@user-pf9rf3sr1q Месяц назад
MYAA NEE
@aittttttttttttt
@aittttttttttttt Месяц назад
we dont know that
@SIMULATAN
@SIMULATAN Месяц назад
held a presentation about the stauffenberg attempt in school, its insane how miniature things like a person moving a briefcase by a few centimeters prevented attacks from succeeding and history changing forever
@BouXIII
@BouXIII Месяц назад
also not forgetting that stauffenberg was no saint. he planned to stop the nazi regime, but wanted to impolement aristocracy again and stop all democratic ideas
@dingsda0412
@dingsda0412 Месяц назад
butterflyeffect
@EEEEEEEE
@EEEEEEEE Месяц назад
E‎ ‎
@CantTellYou
@CantTellYou Месяц назад
And, not so miniature but, the allies bomb causing their fancy new costume ceremony to be canceled. I wonder, what would’ve it been like if Stauffenberg and crew had succeeded? Would it eventually just became another, slightly less genocidal dictatorship? idk much about the guy lol
@aezurefx
@aezurefx Месяц назад
@@dingsda0412 was about to say that
@armansinghbhati8446
@armansinghbhati8446 Месяц назад
Two assassination attempt videos in 2 weeks is MAPPA levels of crazy
@moshymosh
@moshymosh Месяц назад
Weird reference but ok
@Adnan-qf2rz
@Adnan-qf2rz Месяц назад
hes being held captive in some1s basement or sum
@Paradoxical124
@Paradoxical124 Месяц назад
No it isn’t, you’re just young.
@lennywhere
@lennywhere Месяц назад
@@moshymosh weird because the employees of MAPPA are literal slaves or weird because it's an anime prod. company xdxdxd
@Hello-There.-General-Kenobi
@Hello-There.-General-Kenobi Месяц назад
Could you or anybody else explain to me to what op was is referring to please? I know MAPPA but what does it have to do with assassination attemps?
@Zero_Zero_0_0
@Zero_Zero_0_0 Месяц назад
You forgot to add 2 crucial parts in which the meeting was supposed to take place in secured underground concrete bunker but was changed at the last minute due to the extreme heat, and not to mention that initially Staufenburg places the briefcase as close to Hitler, but was unintentionally moved further away by Col. Brandt, thus contributing to another factor as to why he survived the explosion.
@InterlacedStudios1
@InterlacedStudios1 Месяц назад
Noticed that too because I had to learn all about this stuff last year on school
@KingK2205
@KingK2205 Месяц назад
Did Col Brandt survive?
@tom12-128
@tom12-128 Месяц назад
No you are wrong: „It is often falsely claimed that the meeting should actually have taken place in one of the underground bunkers of the Wolf's Lair.“
@bronnquist
@bronnquist Месяц назад
Yes agree, pretty big thing to mention that the bomb was moved.
@After-all-this
@After-all-this 23 дня назад
Imagine if col was a time traveller
@catcatcatcatcatcatcatcatcatca
@catcatcatcatcatcatcatcatcatca 21 день назад
The style of animations is stroke of genius. The little balls tie the keyframes together, as well as look good with low poly details. It really ties the story together, and allows very strong storytelling with the contrasting colors.
@Hungrydinoinyigo
@Hungrydinoinyigo Месяц назад
bro Hitler literally has plot armor
@nietur
@nietur Месяц назад
@@TehUltimateSnake the plot (armor) ended
@creativename.
@creativename. Месяц назад
Bro fr
@agrajyadav2951
@agrajyadav2951 Месяц назад
Yeah the only man who killed Hitler was Hitler himself
@reditoao
@reditoao Месяц назад
just like a little orange somebody 🙄
@volatileM.
@volatileM. Месяц назад
​@@nieturlogically if your plot armor is strong af , the only way to die is suicide 😂
@ScarySkele
@ScarySkele Месяц назад
Just a reminder to people: This video took months to make as do all of them, the previous one not to be mentioned was simplistic in comparison to this so obviously it was pumped out quicker. Don’t judge him on the basis of coincidence, judge him on the basis of journalism, effort, research, and knowledge sharing. fern-tv has my upmost respect.
@tmsupreme7763
@tmsupreme7763 Месяц назад
They released a video about Trump's assasination before this one, I mean I don't mind but still..
@ScarySkele
@ScarySkele Месяц назад
@@tmsupreme7763 I get that, though if you were working on a project for months then got a simpler project done while doing the big one, I think you would empathize with Fern at that point. It isn’t a matter of Trump first, Hitler second. It is a matter of upload main project second, side project first.
@s-ata-n
@s-ata-n Месяц назад
THERE IS NO PROOF JEFFREY EPSTEIN KILLED HIMSELF
Месяц назад
It is not a coincidence. Bruh has no one here had history classes? 😭 It was the 80th anniversary of this assassination attempt on hitler!
@Eisbaer_2912
@Eisbaer_2912 Месяц назад
​@@s-ata-n maybe not for that, but for other videos
@jaunitaquinlivan
@jaunitaquinlivan Месяц назад
<a href="#" class="seekto" data-time="618">10:18</a> I actually went to the place where it happened. It is also worth noting that the briefcase wasn't in the place that it was placed first. Someone had moved the briefcase behind the wooden leg of the table because it was in the way. This caused the explosion to be less impactfull to Hitler as he was further away from the bomb and the wooden leg took some impact on itself.
@EEEEEEEE
@EEEEEEEE Месяц назад
E‎ ‎ ‎
@j0nnyism
@j0nnyism Месяц назад
Wasn’t the table made of concrete?
@onlinefriend3889
@onlinefriend3889 Месяц назад
bot
@Beetless
@Beetless Месяц назад
@@onlinefriend3889 how?
@ilovedollssomuch
@ilovedollssomuch Месяц назад
@@Beetless pfp
@friend
@friend Месяц назад
The rate at which these videos are being pushed out is insane considering how good the production quality is, earned a new sub 👍
@Kalidor99
@Kalidor99 Месяц назад
That's easy, their main channel which has now 400 videos is in German, "Simplicissimus", they just have to translate the old videos to English.
@lyndestructible7088
@lyndestructible7088 Месяц назад
The animations just keep getting better with every video! This looks incredible, keep up the good and informative work.
@hexagonal565
@hexagonal565 Месяц назад
rs
@FreeBoy.
@FreeBoy. Месяц назад
You know its an awesome day, week, and a month overall, when fern uploads.
@xTombou
@xTombou Месяц назад
so every week and therefore every day is awesome? nice
@Oliver-ll6pn
@Oliver-ll6pn Месяц назад
I’d agree
@MrBorisRoblox
@MrBorisRoblox Месяц назад
hop out of the comments nerd
@mac_attack_zach
@mac_attack_zach Месяц назад
stop glazing
@user-bi3oc2jt4t
@user-bi3oc2jt4t Месяц назад
He uploads like every week. You can’t even make a comment you stole funny🤦
@DomsYouTube
@DomsYouTube Месяц назад
I really like this dot projection style animation
@EEEEEEEE
@EEEEEEEE Месяц назад
E‎ ‎
@lordbeetrot
@lordbeetrot Месяц назад
Agree
@EdvinLu
@EdvinLu Месяц назад
Is that the actual name of this animation style?
@d.6786
@d.6786 Месяц назад
@@EdvinLuprojection dot style
@amanprasad139
@amanprasad139 Месяц назад
I hate it More of a pain in eyes, too much going on I like it smooth and clean And if there's some textures that will be great as well
@ailsakatona2415
@ailsakatona2415 Месяц назад
I love how every single object is made of tiny circles it’s so well done and a really interesting video!
@AlexW-
@AlexW- Месяц назад
Hitlers secret: A video camera always running in his pocket ... the camera operator never dies
@reprovedcandy
@reprovedcandy Месяц назад
video cameras didnt even exist back then silly
@AlexW-
@AlexW- Месяц назад
@@reprovedcandy don't know if meta joke or not But yes they did. Just a bit bigger
@gergelyhalasz9754
@gergelyhalasz9754 Месяц назад
​@@reprovedcandy Not true! The very first video camera was created in 1888, 55-57 years prior than these events.
@nursepls4110
@nursepls4110 Месяц назад
PLEASE put actual captions on your videos. The auto generated ones are impossible to use, and your videos are too damn good to miss
@MrBaumGeo
@MrBaumGeo Месяц назад
yeah i agree, its kinda hard for deaf people to view otherwise aswell
@MrBaumGeo
@MrBaumGeo Месяц назад
and i dont mean insane assylum in an offensive way but just so you can imagine because back then it was totally different from a Psychiatric hospitals. they treated people exremely poor
@poorsvids4738
@poorsvids4738 Месяц назад
@@MrBaumGeo what
@whoever_81
@whoever_81 Месяц назад
Auto generated ones seem pretty good to me!
@MrBaumGeo
@MrBaumGeo Месяц назад
​@@poorsvids4738 bro my other comment against nzis was deleted so therefore the context was too. wtf youtube...
@HistoryOnPaper
@HistoryOnPaper Месяц назад
<a href="#" class="seekto" data-time="101">1:41</a> subtitle: “Tesco’s turning point” I think that’s the funniest subtitle ever
@will2056
@will2056 Месяц назад
This moment led to the 2013 invasion of Denmark.
@vijay-jw8gq
@vijay-jw8gq Месяц назад
No more meal deals😢
@marcop.3423
@marcop.3423 Месяц назад
Posting this after the Trump video is insane
@juleha2693
@juleha2693 Месяц назад
Why?
@叵
@叵 Месяц назад
😂
@nathandebusschere7259
@nathandebusschere7259 Месяц назад
Bro dropped the prequel 😭
@HerrZikaPavlovic
@HerrZikaPavlovic Месяц назад
Yesterday was the 80th anniversary of the most well known assassination attempts on him in history, that's probably why.
@nickxplore4265
@nickxplore4265 Месяц назад
It's gonna make sense in 10 years 🤣
@Max-ln1du
@Max-ln1du Месяц назад
Can't tell you how thankful i am for this channel that you 3 created. I came from simpli and moved also a few years prior to the netherlands. This is such a great channel aswell as arte, displaying what the connection of two countrys can do. ❤
@NickHammer99
@NickHammer99 Месяц назад
You guys have such a good channel. The production value is insane and every episode is captivating. Great job
@benitogarcia5069
@benitogarcia5069 29 дней назад
Personally this dudes voice isn’t really intriguing like the other lol
@samtg7507
@samtg7507 Месяц назад
The peak Documentary that you won't find in Netflix and it's for free hats off.
@Ismail-es2ld
@Ismail-es2ld Месяц назад
It makes so much sense now how you compiled your last video so fast! Having this video in the works came in clutch
@hans7856
@hans7856 Месяц назад
You failed to mention that Stauffenberg's briefcase was also moved, and a thick table leg protected Hitler from the blast.
@user-jw5lj9wu2g
@user-jw5lj9wu2g Месяц назад
Ist halt schon krass wie stark ihr die Reichweite erhöhen konntet und halt die Qualität massiv verbessert, keep doing
@1oxin
@1oxin Месяц назад
<a href="#" class="seekto" data-time="367">6:07</a> just to think if the allies didnt bomb, the war wouldve been over a lot quicker 💀
@christianc8453
@christianc8453 Месяц назад
It’s really wild what you can uncover about history when you teach yourself. “History is written by the victors.”
@_WyngX
@_WyngX Месяц назад
Wow fern.. your animation just gets better and better every video.. I'm jealous! :D
@rulers8969
@rulers8969 Месяц назад
I'm the first person to comment on you channel.
@_WyngX
@_WyngX Месяц назад
@@rulers8969 HEy mate! :D
@rulers8969
@rulers8969 Месяц назад
@@_WyngX hi brother
@rulers8969
@rulers8969 Месяц назад
@@_WyngX I sub to you.
@busterrex7588
@busterrex7588 Месяц назад
Fern, your videos are too amazing. From when I first clicked on the Whittinoom video I have been hooked on this channel you guys somehow are able to produce such great quality videos whist still uploading consistency and often! Just wanted to say I appreciate the effort that goes into these videos. Cheers
@aggravated_assault
@aggravated_assault Месяц назад
Because they were backed by the german public broadcasting
@anderson._.._.8801
@anderson._.._.8801 Месяц назад
Yup, the simplicissimus guys are great 👍
@Colmath
@Colmath Месяц назад
There is an argument to be made that him being alive actually made the war shorter. His involvement in military command from 1941 was so disastrous, so incompetent that it made huge Allied advances possible. Had he been assassinated and the German military been left to "do its job", they might have been able to hold out for longer. So in a weird way, the most evil dictator not dieing soon enough might have actually lead to fewer deaths than him becoming a martyr and even worse people coming to power.
@MacenW
@MacenW Месяц назад
Weird take
@boneman5569
@boneman5569 Месяц назад
@@MacenWweird but definitely reasonable
@shidditiddis
@shidditiddis 19 дней назад
Everything happened as it was supposed to
@saacde
@saacde Месяц назад
Fern keeps on dropping banger after banger this whole month?! Thank you for all the content
@--AnonymousUser--
@--AnonymousUser-- Месяц назад
<a href="#" class="seekto" data-time="10">0:10</a> You made a mistake here. That's the Bunker-Hitler outfit from Spring 1945, not the Chancellor outfit from late 1939.
@6mtsaab
@6mtsaab 22 дня назад
Bruh who cares
@Abdullah0091a
@Abdullah0091a 21 день назад
​@@6mtsaab I care
@MangoCraftblx
@MangoCraftblx 21 день назад
​@@Abdullah0091a not me
@tobiwan001
@tobiwan001 Месяц назад
<a href="#" class="seekto" data-time="633">10:33</a> it’s the Bendlerblock (not Blenderblock). It was a city block in Bendlerstrasse. Now the street is called Stauffenbergstrasse - obviously.
@eternalslumber2k6
@eternalslumber2k6 Месяц назад
Keep this video quality up and keep covering such interesting subjects and you will become one of the most popular channels on this platform for sure.
@Clock_Man_2763
@Clock_Man_2763 Месяц назад
Two assassination videos in less than a week is crazy, Fern really cooks well 🔥🔥
@thePaloo
@thePaloo Месяц назад
Your storytelling is incredible and documentary-level. Many thanks for this video!
@5upl1an
@5upl1an Месяц назад
Its easy, someone wrote his name in a Death Note with the date 30. April 1945 which made him pratically immortal until that day.
@goblincomic4522
@goblincomic4522 Месяц назад
I though maximum day for death note is 23 days ?
@looniemoonie5955
@looniemoonie5955 Месяц назад
@@goblincomic4522 yes. It's just a joke. I don't remember if it's 23 days, I thought it was around 28
@obnoxious_moron
@obnoxious_moron Месяц назад
you can't extend someone's life with the death note
@Apfelloch
@Apfelloch Месяц назад
I really like this "point cloud" style animation and the transitions. Probably saves a lot of time in comparison to actual walking animations. However, all these little dots are pretty hefty on RU-vids compression algorithm such that some scenes become blurry. Tom Scott has a great video about this ("Why Snow and Confetti Ruin RU-vid Video Quality").
@Brandonlandis
@Brandonlandis Месяц назад
the worst dude in history has the most luck and i cant even win $10 on a scratch off lottery ticket
@Dr.W.Krueger
@Dr.W.Krueger 27 дней назад
There were far greater butchers throughout history
@Nippleless_Cage
@Nippleless_Cage 18 дней назад
Not with Hitler's level of sophistication and premeditation. ​@@Dr.W.Krueger
@BrendanLorenzo
@BrendanLorenzo Месяц назад
The aesthetic of the animation is so unique and lends itself beautifully to the storytelling 👌
@rahmi.digital
@rahmi.digital Месяц назад
Unglaubliches Timing und unfassbar gut umgesetzt. Hut ab vor dem gesamten Team!
@rjbeatz
@rjbeatz Месяц назад
The irony is that he ended up killing himself after all the attempts 💀
@mrbilter83
@mrbilter83 Месяц назад
"Fine i'll do it myself" - funny mustache man, 1945 -
@the_mastermage
@the_mastermage Месяц назад
He be like fine I'll do it myself
@user-td2jw9ze2c
@user-td2jw9ze2c Месяц назад
He ran to South America
@mariopasta
@mariopasta Месяц назад
Or maybe not
@shashwatgrover1
@shashwatgrover1 Месяц назад
Maybe they would have said that Trump also did it himself 🤷🏻‍♂️
@LG23-ho3zk
@LG23-ho3zk Месяц назад
Hitler is the real life stupid comically evil villain that the franchise keeps on reviving Edit: dawg this pfp is satire, I ain’t actually ancap
@Neverlose001
@Neverlose001 Месяц назад
O.J. Simpson
@dikipprasad
@dikipprasad Месяц назад
Look who's saying that 😂
@unnameduser-1
@unnameduser-1 Месяц назад
sus profile pic
@Snp2024
@Snp2024 Месяц назад
​@@unnameduser-1why
@unnameduser-1
@unnameduser-1 Месяц назад
@@Snp2024 dont get it? look at the colors 🟨⬛
@realpv_aka_vp
@realpv_aka_vp Месяц назад
Despite the fact that i know that its a coincidence, this video's timing is the funniest thing I've seen in a while even though other people, including the creators, might disagree, this is kinda meaningful as well
@saltywater5097
@saltywater5097 Месяц назад
You are the problem.
@realpv_aka_vp
@realpv_aka_vp Месяц назад
@@saltywater5097
@Ostro-goth
@Ostro-goth Месяц назад
@@saltywater5097womp womp
@Jonathan_drg
@Jonathan_drg Месяц назад
Ihr übertrefft euch mit den Videos mittlerweile selbst! Die Animationen sind 💯💯
@striderwhiston9897
@striderwhiston9897 Месяц назад
This artstyle of yours kinda reminds me of those war flashback cutscenes in call of duty ghosts.
@Alex-rn6rr
@Alex-rn6rr Месяц назад
Cant wait to watch this on Simplicissimus
@Turkishgameinvader
@Turkishgameinvader Месяц назад
That bastard survived 43 assasinations dude he has some kind of plot armor
@PushyPawn
@PushyPawn Месяц назад
You guys put so much work into your animation that in 4K, I swear I can see individual molecules and atoms! 👏
@ashtonalexander8760
@ashtonalexander8760 Месяц назад
Channels like yours are great for the mass of people who don’t know the history of such things as well as WW2 and history enthusiasts like myself. I’d love to see your take on the the events of Operation Anthropoid. The general public knows so little of these great stories of valor and courage.
@ericayoo5101
@ericayoo5101 Месяц назад
Hitler’s survival tells us how persistent Satan reigns until the end. This is really frustrating.
@ChristlsGod
@ChristlsGod Месяц назад
true
@moonmelo_rocket2636
@moonmelo_rocket2636 Месяц назад
Welcome back german comentator, missed you
@just_mdd4
@just_mdd4 Месяц назад
Fern must've planned these videos! 😝
@just_mdd4
@just_mdd4 Месяц назад
Disclaimer: Yes, I know the timing was not intentional.
@Paradoxical124
@Paradoxical124 Месяц назад
@@just_mdd4why make the comment then 🤦‍♂️
@Hyperlaser_Merc
@Hyperlaser_Merc Месяц назад
Its funny, ​@@Paradoxical124
@Paradoxical124
@Paradoxical124 Месяц назад
@@Hyperlaser_Merc I suppose that’s my issue because I didn’t laugh 😞
@ftr98
@ftr98 Месяц назад
Yes because yesterday was the 80'th anniversary of the stauffenberg attentat
@anasqai
@anasqai 23 часа назад
If it's inside a vase, maybe easily if long distance stethoscope if can hear ticks to vases that's safe to walk(due to the scheduled moment), vase pattern looks easy to remember. Means somehow they break vase and place the bomb after that, means their wire is taken out after vase breaks to hide how it looks like(the before-defuser moment to think of wire to cut).
@Housewarmin
@Housewarmin Месяц назад
It is music to my ears to hear you say these names properly. I love your accent
@user-pq3ft2mn5x
@user-pq3ft2mn5x Месяц назад
Raelly😢
@Cypher791
@Cypher791 Месяц назад
They don’t make tables like that anymore… ✋😆
@dhavalshah2612
@dhavalshah2612 Месяц назад
babe wake up, new Fern video dropped.
@Lt_Koro
@Lt_Koro Месяц назад
I was gonna comment on how this video after the trump video is weird, but pushing the trump video out as quickly as possibly was just important and yesterday was the 80th anniversary of this event, so it really cant be malicious in any way.
@orfoisus
@orfoisus Месяц назад
Damn! Brilliant really spent A TON on this recent youtube-wide ad-spree
@johannesr8709
@johannesr8709 Месяц назад
The dust visuals and animations are absolutely insane ! Amazing work!
@foudie
@foudie Месяц назад
i mean they could've just put the other unarmed bomb with the armed bomb in the brief case, so when the first bomb explodes the other one would too.
@grimnippz7398
@grimnippz7398 Месяц назад
depends on the explosive used, it could have just blown the second bomb apart failing too detonate.
@Marcel-yu2fw
@Marcel-yu2fw Месяц назад
@@grimnippz7398 But it couldn't hurt to put in the other bomb too, right? Just in case it works.
@hwfq34fajw9foiffawdiufhuaiwfhw
@hwfq34fajw9foiffawdiufhuaiwfhw Месяц назад
not that i have knowledge of bomb making, but that would likely just shatter the other bomb into shrapnel like it was any other object in the blast radius. wouldn't be the same as a second bomb exploding (overheated) soda can vs firing a bullet through a soda can
@cuboidmelon
@cuboidmelon Месяц назад
If it was minecraft, then yeah...
@grimnippz7398
@grimnippz7398 Месяц назад
The explosives used required a chemical reaction for the detonation, meaning the pressure of the second bomb would have had almost no chance too undergo detonation. However as a redundancy it couldnt have hurt.
@0h5ive
@0h5ive Месяц назад
holy shit he still alive?!
@Kaanooo
@Kaanooo Месяц назад
Ich frage mich immer wie solche Videos entstehen. Also ernsthaft, wie funktioniert die Animaton der Videos? Wie werden die Themen rausgesucht ? Man merkt das viel Mühe und Arbeit reingesteckt wird und deswegen schaue ich sie mir auch gerne an.
@skorp5677
@skorp5677 Месяц назад
Simpli haben halt inzwischen ne recht große Redaktion. Auf dem Kanal gab es glaube ich auch mal irgendwann ein Video zum Entstehungsprozess. Vielleicht auch auf 2BG
@Kaanooo
@Kaanooo Месяц назад
@@skorp5677 ah ok, danke für die antwort.
@mariusbcc7391
@mariusbcc7391 Месяц назад
How is this the first time I saw this channel its so good + the sources this needs more views.
@timr.2257
@timr.2257 Месяц назад
1: Aren’t there better methods back then than relying on chemicals for a time bomb? 😅 2: They don’t even pat down new people that gets close to Hitler?
@concept5631
@concept5631 28 дней назад
Nazi's aren't known for being smart.
@marianandnorbert
@marianandnorbert Месяц назад
HE CAN'T KEEP GETTING AWAY WITH IT
@g3nj1
@g3nj1 Месяц назад
The tried to put Adolf in a self defense situation and found out.
@Bloidz7
@Bloidz7 Месяц назад
Fern is on his assassination video arc
@dragonite87140
@dragonite87140 Месяц назад
2 assassination attempt videos from Fern in a week is crazy
@marksantiago9841
@marksantiago9841 Месяц назад
I think you missed something. The briefcase was placed near hitler, but it was moved by heinz brandt because it was in his way.
@rostislav.lisovy
@rostislav.lisovy Месяц назад
Ok... so showing all those explosions, talking about killing someone, showing human figures with grenades in their pockets and explaining they would have also killed themselves is ok... but for some reason you have to "censor" the word "suicide"?
@myaccount__7269
@myaccount__7269 Месяц назад
Blame RU-vid who de mometizes bad words
@jakedee4117
@jakedee4117 Месяц назад
I thought the same thing myself, but it's RU-vid rules, and perhaps censored automatically by algorithm not by a human who understands the full subject matter. I recently have heard RU-vidrs saying, "He un-alive himself!"
@ergwertgesrthehwehwejwe
@ergwertgesrthehwehwejwe Месяц назад
At what point do we stop forgiving youtubers for bending the knee to censorship like this? Nobody seems to have a spine anymore
@myaccount__7269
@myaccount__7269 Месяц назад
@@ergwertgesrthehwehwejwe it’s either this or they get zero money. Do you work for free? As I said…blame RU-vid
@keisuketakahasi4584
@keisuketakahasi4584 Месяц назад
@@myaccount__7269 dont hate the player, hate the game
@DiplexHeated
@DiplexHeated Месяц назад
The people who think it’s crazy dropping this after the Trump video are the ones associating Trump with Hitler, not the channel.
@mao-tse-tung-games
@mao-tse-tung-games Месяц назад
It wasn't planned, but when it happened, they grabbed the opportunity. Truly a deficit of respect
@BlackoutWH
@BlackoutWH Месяц назад
@@mao-tse-tung-games Or maybe it was the 80th anniversary of the attempt mhhh.... nahh they just grabbed the opportunity
@Stijn5
@Stijn5 Месяц назад
@@mao-tse-tung-games Boohoohoo. The orange sociopath is impossible to respect.
@johnnyxmusic
@johnnyxmusic Месяц назад
@@Stijn5 you know it’s fantastic… Powered by the right AI algorithm… Every disparaging comment about a certain person could probably be collected in one afternoon… And go on a certain persons list… A certain person who is planning on creating concentration camps… And when the people in those concentration camps are emptied out… They’ll be plenty of room for people who don’t go along with the agenda of that certain person. I believe the camps in Germany at least one of them were created As rehabilitation camps. That’s the one that has a certain phrase over the gateway…
@micahsarm
@micahsarm Месяц назад
@@mao-tse-tung-games Respect should be given to those who deserve it, not to those like Trumpie.
@JollyBubuyug
@JollyBubuyug Месяц назад
The fact he got away from all of those assassinations but not the assassination from himself.
@Qba116
@Qba116 Месяц назад
Love that you included (or maybe "excluded") Stauffenberg's missing right hand!
@nyfex4190
@nyfex4190 Месяц назад
Jonas is the perfect speaker for this topic, since there are so many notable German personalities in those happenings
@vincent-of7vo
@vincent-of7vo Месяц назад
Today, we remember Claus schenk Graf von stauffenberg🕊️
@nelo1453
@nelo1453 Месяц назад
Ungewöhnlich Euch auf Englisch zu gucken wenn man nur Simplicissimus gewohnt ist
@lukemontgomery1774
@lukemontgomery1774 Месяц назад
You'd think after 40 attempts he'd take the hint
@alphakevin687
@alphakevin687 Месяц назад
Fascists are not the smartest bunch
@antdiamond64
@antdiamond64 Месяц назад
He did
@Willy_Tepes
@Willy_Tepes Месяц назад
That the hand of God was protecting him?
@user-gi7vi9gm4t
@user-gi7vi9gm4t Месяц назад
@@Willy_Tepes if god was mean : , no it has to be a coincidence
@Willy_Tepes
@Willy_Tepes Месяц назад
@@user-gi7vi9gm4t God takes care of his servants..
@oowena
@oowena Месяц назад
everything abt your channel is amazing you upload frequently and the animation is just amazing and so is the story telling keep up the great work
@mystischertelefant8868
@mystischertelefant8868 Месяц назад
Perhaps also interesting: the actual assassination attempt, which Staufenberg had carried out that day, was postponed again shortly beforehand, to the “Wolf's Lair” away from the actual venue. This also had an enormous influence on the outcome of the situation, as the oak table was able to absorb the pressure of the detonation and the open windows were also able to release the pressure into the surrounding area. The meeting was actually planned in a bunker, where the pressure would have further damaged the room and caused more damage. This was also one of his strategies, canceling or changing locations or times at short notice.
@GeorgeNoah-xf9tb
@GeorgeNoah-xf9tb Месяц назад
Hallelujah 🙌🏻!!!!! The daily jesus devotional has been a huge part of my transformation, God is good 🙌🏻🙌🏻. I was owing a loan of $49,000 to the bank for my son's brain surgery, Now I'm no longer in debt after I invested $11,000 and got my payout of $290,500 every month…God bless Mrs Susan Jane Christy ❤️
@PoynterGeesey
@PoynterGeesey Месяц назад
Hello!! how do you make such monthly, I’m a born Christian and sometimes I feel so down of myself 😭 because of low finance but I still believe God
@NoahOliver-rx3mp
@NoahOliver-rx3mp Месяц назад
Thanks to my co-worker (Carson ) who suggested Ms Susan Jane Christy
@KleffmanRosenbush
@KleffmanRosenbush Месяц назад
She's a licensed broker here in the states🇺🇸 and finance advisor.
@KleffmanRosenbush
@KleffmanRosenbush Месяц назад
After I raised up to 525k trading with her I bought a new House and a car here in the states🇺🇸🇺🇸 also paid for my son's surgery….Glory to God, shalom.
@LouisPeters-fw9cg
@LouisPeters-fw9cg Месяц назад
Can I also do it??? My life is facing lots of challenges lately
@Mightydoggo
@Mightydoggo Месяц назад
Haha! The timing is just glorious, I think the universe wants to tell us something. lol And yeah, every halfway sane person knows how long it takes for such a video to make. It´s a coincidence, but a really funny one.
@nikoraasu6929
@nikoraasu6929 Месяц назад
timing on what
@mao-tse-tung-games
@mao-tse-tung-games Месяц назад
Nah. They had been working for a while, sure, but they get to decide when it uploads. It's not a mere "coincidence". It's their strategy of getting the algorithm on their side. And they got it.
@BlackoutWH
@BlackoutWH Месяц назад
​@@mao-tse-tung-gamessure it's not like the most famous attempt in the video had its anniversary the day before it got released
@TheOGRokma
@TheOGRokma Месяц назад
Odd coincidence of when this video came out🤔
@kanjiking
@kanjiking Месяц назад
The quality of your animations has become just insane. Love your work.
@udiniali
@udiniali Месяц назад
the production level is crazy
@hanibalfischkopf6286
@hanibalfischkopf6286 Месяц назад
Hitler put all his skill points in luck.
@ShowCasesGD
@ShowCasesGD Месяц назад
SHUT UP MOM FERN UPLOADED
@TheCommentor-
@TheCommentor- Месяц назад
Hitler has so much plot armour, he was the only person that could kill Hitler
@Nobody.exe50
@Nobody.exe50 25 дней назад
the production value of this is amazing
@chasemcm
@chasemcm Месяц назад
Most of you are too young to know good films. But you should watch these 4 fantastic ww2 films. One which is specifically about this topic, called “Valkyrie” , another great one is “The Pianist”, or “the boy in the striped pajamas” or of course the most famous “saving private ryan” All amazing films.
@sleepingmelons8420
@sleepingmelons8420 Месяц назад
Why is RU-vid posting Wikipedia articles.
@DoFliesCallUsWalks
@DoFliesCallUsWalks Месяц назад
fern is on an Assassination streak.
@ConsumerOfCringe
@ConsumerOfCringe Месяц назад
"guys lets not critisize hitler, they nearly assassinated him, we need unity in germany"
@f1nTiVR
@f1nTiVR Месяц назад
The amount of skill that goes into these animations is crazy and I know because of experience
@NeobanditRS3
@NeobanditRS3 Месяц назад
i guess this is a good time to remember history in a weird twisted way. ty algorithm
@espanolbeef2901
@espanolbeef2901 Месяц назад
<a href="#" class="seekto" data-time="730">12:10</a> not as if millions more people of other religions, ethnicities and those with disabilities weren’t killed as a result of his policies and the German war effort. Why would only one group of people be highlighted if they were only a fraction of the total casualties of the war?
@heroofjapan
@heroofjapan Месяц назад
The timing to post this video is sus
Далее
Why the US didn't Nuke Tokyo
19:36
Просмотров 3,1 млн
White Death: The World’s Deadliest Sniper
8:15
Просмотров 5 млн
Moto Trial vs Moto acrobática 🏁
00:29
Просмотров 2,3 млн
What Happened to Hitler's Body
19:52
Просмотров 9 млн
Putin's Hidden Bunkers
13:08
Просмотров 2 млн
How a Pilot Hijacked a Plane
11:56
Просмотров 5 млн
How the Most Elite Spy Agency Operates
22:42
Просмотров 1 млн
The O.J. Simpson Chase
19:02
Просмотров 3 млн
Australia's Secret Chernobyl
13:21
Просмотров 1,9 млн
The Hunt for Ted Bundy
22:12
Просмотров 3,2 млн
Germany: The Dark Secrets of the Super Rich
27:56
Просмотров 2,3 млн
Why is Russia So DAMN BIG?
17:25
Просмотров 7 млн
Why the World's Biggest Aquarium Broke
12:23
Просмотров 1,4 млн