Тёмный

Topology Riddles | Infinite Series 

PBS Infinite Series
Подписаться 314 тыс.
Просмотров 170 тыс.
50% 1

Viewers like you help make PBS (Thank you 😃) . Support your local PBS Member Station here: to.pbs.org/don...
Can you turn your pants inside out without taking your feet off the ground? Start your free trial with Squarespace at squarespace.com... and enter offer code “infinite” to get 10% off your first purchase. And check out Vanessa Hill’s documentary Mutant Menu right here! • MUTANT MENU | The Et...
And special thanks to Danny Haymond Jr aka @slothman86 for for his incredible fan art!
Tweet at us! @pbsinfinite
Facebook: pbsinfinite series
Email us! pbsinfiniteseries [at] gmail [dot] com
Previous Episode
Building an Infinite Bridge
• Building an Infinite B...
The Heart of Mathematics
www.amazon.com...
Picture Hanging Article:: arxiv.org/pdf/...
Written and Hosted by Kelsey Houston-Edwards
Produced by Rusty Ward
Graphics by Ray Lux
Made by Kornhaber Brown (www.kornhaberbrown.com)
Find out why Topology is often called Rubber Sheet Geometry and try to solve these counter-intuitive topological puzzles.
Challenge Winners:
Alan Chang
@Chalkface
Comments answered by Kelsey:
Louis JX
• Building an Infinite B...
Erdmannelchen
• Building an Infinite B...

Опубликовано:

 

10 сен 2024

Поделиться:

Ссылка:

Скачать:

Готовим ссылку...

Добавить в:

Мой плейлист
Посмотреть позже
Комментарии : 512   
@22222Sandman22222
@22222Sandman22222 7 лет назад
This is why coffee and donuts go so well with each other, they are topologically similar
@user-pr6ed3ri2k
@user-pr6ed3ri2k Год назад
that only works for the mugs, although the thought of coffee in a shape that's homeomorphic to a donut is quite funny
@SawtoothWaves
@SawtoothWaves 7 лет назад
Is this it? Is this how you turn a sphere inside-out?
@alwinpriven2400
@alwinpriven2400 7 лет назад
same area of maths. same level of weirdness.
@cykwan8534
@cykwan8534 7 лет назад
The Brony Notion you bet!
@jesusthroughmary
@jesusthroughmary 7 лет назад
+The Brony Notion groan, so cringy
@jesusthroughmary
@jesusthroughmary 7 лет назад
+HerebyOrdinary He's quoting that video. Come on, dude.
@SawtoothWaves
@SawtoothWaves 7 лет назад
HerebyOrdinary I've seen it. Very interesting stuff.
@matthewgiallourakis7645
@matthewgiallourakis7645 7 лет назад
My solution for the pants was to invert the top of the pants out and down to the floor, and invert the legs back up through themselves, so that the pants are inverted but also upside-down.
@egilsandnes9637
@egilsandnes9637 7 лет назад
Matthew Giallourakis That was my thought also. She should have specified that they should be "on" like normal.
@egilsandnes9637
@egilsandnes9637 7 лет назад
Yes, wearing your pants inverted and upside down is a terrible trend! We must stop it before it even starts.
@jeffirwin7862
@jeffirwin7862 7 лет назад
Yeah, you don't even need crazy clown pants for this. I can do it with normal fitting sized gym shorts.
@danswanick7854
@danswanick7854 7 лет назад
Matthew Giallourakis same
@salaprance5283
@salaprance5283 3 года назад
I thought of it in that way as well!!
@alkankondo89
@alkankondo89 7 лет назад
The fact that this series of videos exists is really encouraging. The way the videos are set up, fostering math dialogue in the comments and having a challenge question at the end - is an excellent way to communicate otherwise-intimidating math concepts and intuition to the masses! You have earned my subscription!
@pivotman64
@pivotman64 7 лет назад
See numberphile's "a hole in a hole in a hole"
@VorganBlackheart
@VorganBlackheart 7 лет назад
That guy was high on math, plus 3-handle beer mug ftw
@ganaraminukshuk0
@ganaraminukshuk0 7 лет назад
Three hole donut plus three handle coffee mug equals a slightly weird time at the office.
@Silverwind87
@Silverwind87 6 лет назад
I'm 99.99% convinced that the guy in that video is a mad scientist, er, mathematician.
@Immortalcheese
@Immortalcheese 5 лет назад
Mathematician pick-up line: "let your pants be topological"
@robinsparrow1618
@robinsparrow1618 7 лет назад
I'm pretty sure that you can stretch a human shape into a t-shirt shape. Nostrils become the sleeves, mouth becomes collar, and "aboral" end becomes the bottom opening.
@samory2761
@samory2761 7 лет назад
Don't forget the ears. BTW that is one disgusting shirt
@robinsparrow1618
@robinsparrow1618 7 лет назад
Do the ears go into the same cavity as the mouth?
@GREENSP0RE
@GREENSP0RE 7 лет назад
You technically have the outer and middle ear separated by the ear drum, with the middle ear connected to your sinuses via the Eustachian tubes. Since these are dead ends they act like the "cup part" of a coffee cup and do not count as holes.
@robinsparrow1618
@robinsparrow1618 7 лет назад
Yeah, that's what I was thinking. I'm also pretty sure that the bladder is separate from the intestines. So that would leave only four holes going into the digestive system. Making a human a genus-3 surface, same as a t-shirt.
@william41017
@william41017 7 лет назад
Cajer 1618 don't nostrils have dead end?
@HiveMindedGod
@HiveMindedGod 7 лет назад
I want to hang that picture on my wall. My two favorite PBS series hosts.
@zachm5136
@zachm5136 4 года назад
I spent a while at the beginning of the video. I paused the video as soon as I heard "if you were wearing really stretchy pants, could you remove them without lifting your feet." My answer is no, but let's see if I'm wrong lol. I was stuck for a while, but soon realized that the pants can be reduced to essentially a rectangle with two holes, where the two holes come from the two pant legs. The waist part can be expanded and flattened to the floor in the shape of a rectangle. The rectangular part isn't so important, but it is important to note that the pants are homeomorphic to something with two "holes". So from there, I envisioned standing with my left foot in one of the holes, and my right foot within the other hole - While the rest of the rectangular part lay around my feet, on the floor. From here, I guess you could lift the other hole up and over to the other foot, but from there, with the two holes stacked on top of one another, there is no way to remove it from both legs. And I think another thing worth mentioning is that, while the pants have two holes essentially, our entire figure (with out legs, hips and floor making a sort of triangle) has just one hole. The arms and torso, etc., do not contribute to any additional holes. Now if we take what we've learned from VSauce, we know that the body has a couple of "Through holes," such as the gastrointestinal tract. If we include this as a part of our solution space, MAYBE we can remove the pants! Let's see if I'm wrong! Edit: That wasn't even the right question. ;[
@alexmcgaw
@alexmcgaw 7 лет назад
10:57 "negative 1 plus positive 1 plus negative 1 never settles on a value" tell that to numberphile
@dylanrambow2704
@dylanrambow2704 7 лет назад
Under the standard definition of convergence, the sum of (-1)^n diverges. But it converges under a broader definition of convergence called Cesaro convergence. en.wikipedia.org/wiki/Ces%C3%A0ro_summation
@alexmcgaw
@alexmcgaw 7 лет назад
Dylan Rambow Indeed. They didn't say that in the video though, did they!
@dylanrambow2704
@dylanrambow2704 7 лет назад
Nope. Usually with any youtube math video, you need to dig a bit deeper to get to the actual rigor of what's going on.
7 лет назад
With the logic that 1+1-1+1-1+...=-1/12 you can also say that sqrt(-1)=infinity or -infinity, depending on how you execute the approximation algorithm.
@dylanrambow2704
@dylanrambow2704 7 лет назад
I think you have your series mixed up. The series (-1)^n=1+1-1+1-1+1... converges to 1/2. The sum of all natural numbers, 1+2+3+4+5+... converges (through 'analytic continuation') to -1/12.
@andrasfogarasi5014
@andrasfogarasi5014 6 лет назад
Two shapes that are topologicaly equivalent? A human digestive system. A donut.
@JR1481M1
@JR1481M1 6 лет назад
You read my mind, seriously.
@mixedfeelingsaboutturning1910
@mixedfeelingsaboutturning1910 3 года назад
No because there is different passages that connect
@Silverwind87
@Silverwind87 6 лет назад
Could you imagine a topological donut in real life? It'd be the ultimate fidget toy.
@flymypg
@flymypg 7 лет назад
There seems to me to be an evolution across the PBS Digital series, where the subjects vary from the very deep to the very accessible, but doing so by being "accessibly deep" and "deeply accessible". That is, seeing the mystery in common everyday observations, and finding clarity in deep and obscure theory. It's like a boxer working an opponent from low to high and back, but in this case seeking ways to impart knowledge rather than punches. Thanks!
@Minecraftster148790
@Minecraftster148790 7 лет назад
I once managed to put a jumper on underneath my jacket while keeping the jacket still zipped up
@fossilfighters101
@fossilfighters101 7 лет назад
+
@alexwang982
@alexwang982 7 лет назад
Minecraftster148790 what is a jumper
@quintenvanveen3031
@quintenvanveen3031 4 года назад
Pi a sweater you American
@garrettzucker2894
@garrettzucker2894 4 года назад
You should do that every day to practice mental strength
@koscinski3697
@koscinski3697 3 года назад
Then something was probably wrong or out of place, that isn't possible!
@AlanKey86
@AlanKey86 7 лет назад
Sometimes people ask "what's the point of this?" on math videos. I feel like the hanging picture puzzle is trolling such people.
@zacharyalbright4222
@zacharyalbright4222 6 лет назад
This happens with my pants every time I try to take them off when I'm drunk😂😂😂
@apteropith
@apteropith 7 лет назад
0:00 After careful consideration: yes, by pulling the waistband over one's head, closing it and treating the garment like a pantleg tube. Somewhat acrobatic. 2:35 Seeing this part helped me visualize how the loops swap when just pulling the original depiction inside-out. 2:50 Oh, well there it is. 8:21 Well, that's more efficient.
@ryanitlab
@ryanitlab 7 лет назад
This is one of my favorite videos to come out of the Infinite Series. The topic is enjoyable, and the comedy is perfect
@JohnGolden
@JohnGolden 7 лет назад
"I left the proof in my other pants," has never been more true.
@GeoQuag
@GeoQuag 7 лет назад
To the question posed at 11:15, if you add all of the terms defined by the sequence 1/n^p, the resulting series will converge as long as p>1, no matter how close you get, and it will diverge if p≤1. In a sense, 1/n is the series on the cusp of converging.
@treufuss-yt
@treufuss-yt 7 лет назад
Jup, that's what I was thinking about as well. It confused me that 1/1+1/2+1/4+1/8+1/16 .... does not generalize to 1/n^2 but (1/2)^n. So I am not sure whether op means the geometric series or the p-series.
@stevethecatcouch6532
@stevethecatcouch6532 7 лет назад
That series is on the verge of converging, but it's a wide verge. The series 1/n for n = 1, 3, 5, ... diverges more slowly so it's arguably "more convergent" than 1/n for n = 1, 2, 3 ... And you can always find a series that diverges even more slowly. So in addition to an infinite sequence of series that are "almost divergent", there is an infinite sequence of series that are "almost convergent". It seems to me that the ideal answer would be a series for which convergence is undecidable. I have a memory, possibly a false one, of learning about such a series many, many years ago.
@franzluggin398
@franzluggin398 7 лет назад
Convergence cannot be undecidable if you know the underlying sequence that you add together. Of course, you cannot decide whether sum_{i=1}^{n}a_i converges for n to infinity, without knowing what the sequence (a_i)_{i in IN} is. But as long as you know that, there are only two possible cases: - There exists a real number R such that sum_{i=1}^{n}a_i comes arbitrarily close to zero for larger and larger n (and for any given tolerance epsilon, you can find a natural number n such that the difference is at most epsilon _for every natural number larger than n_). - For every real number R there exists a given tolerance epsilon such that the distance of the sum up to n to the number R will stay bigger than epsilon _for infinitely many numbers n_. The way the natural numbers work, you always have one of those two cases up there. The only way to not have infinitely many n with distance bigger than epsilon is to only have finitely many n (duh!), and finitely many n have a largest element. After that largest element, all others will have tolerance smaller than epsilon, or the largest element wouldn't in fact be the largest element for which the distance is bigger than epsilon.
@treufuss-yt
@treufuss-yt 7 лет назад
+Franz Luggin I am not sure you know what undecidable means. The question whether an algorithm terminates or not has also only two possible answers but this problem is undecidable. In general, the question whether a series converges or not is indeed not decidable, simply for the reason that there are uncountable many series.
@franzluggin398
@franzluggin398 7 лет назад
As I said, if you know what the sequence a_i is, i.e. if there is one sequence given, you have enough information to decide what the answer is. There are convergence tests that work even though you do not know what the limit is.
@playlistking4303
@playlistking4303 6 лет назад
Topology is my new favorite math subject.
@brooke0xff
@brooke0xff 7 лет назад
Please do the rest of the series in those pants
@LordMichaelRahl
@LordMichaelRahl 7 лет назад
Smooth.
@kallansi4804
@kallansi4804 7 лет назад
I knew i wasn't the only one hounding
@jesusthroughmary
@jesusthroughmary 7 лет назад
And turn them inside out at the end of every episode.
@everburningblue
@everburningblue 7 лет назад
I want to know what black magic is keeping them on her hips.
@jesusthroughmary
@jesusthroughmary 7 лет назад
Daniel Smith She's topologically​ equivalent to Shakira.
@zairaner1489
@zairaner1489 7 лет назад
Ah pleaso more on the fundamental group!
@talisozols9984
@talisozols9984 7 лет назад
Quote of the day: "Let your pants be topological"
@maxc101
@maxc101 7 лет назад
By the way, genetics has ties to knot theory which is related to topology. Bacteria use special turing-like "algorithms" to untangle their own DNA when it gets knotted. They do so using a mathematically minimum number of DNA slices and how they do it exactly is not only not known by scientists but also requires solutions to problems in knot theory that we still don't know yet. (correct me if I'm wrong - my information is not completely upto date. Here's some fun: I thought of a good idea... find a set of 4 characters in the ascii extended chars that can represent the gene sequences A T G and C so that when negated, the image is it's opposite (A T) (GC). Here's what I came up with: A = • (black circle in a white box) T = ◘ (white circle in a black box) G = ○ (black ring in a white box) C = ◙ (white ring in a black box) If you express the Genes rather than atgtactgtca, but as it's RNA/inverse-RNA pairing is it would be in nature (nature's redundancy plan) then inverted blackwhite, equals it's flipped image... cggatttagcgagtaattctacgagaatagcgactgtaagtacggacttggcaagtaatt gcctaaatcgctcattaagatgctcttatcgctgacattcatgcctgaaccgttcattaa ◙○○•◘◘◘•○◙○•○◘••◘◘◙◘•◙○•○••◘•○◙○•◙◘○◘••○◘•◙○○•◙◘◘○○◙••○◘••◘◘ ○◙◙◘•••◘◙○◙◘◙•◘◘••○•◘○◙◘◙◘◘•◘◙○◙◘○•◙•◘◘◙•◘○◙◙◘○••◙◙○◘◘◙•◘◘•• By the way, this may work better with a monospace font like Lucida Console. Just bored and looking for things to entertain on the weekend. :-)
@t.e.d
@t.e.d 7 лет назад
Why are you not breaking the rule about glueing an existing hole closed at 3:13?
@gJonii
@gJonii 7 лет назад
I'm not really sure how to explain that hole disappearing. I was gonna say the hole was just an illusion, but it's not. Confusing. Anyhow, to get intuition about how this thing works, try this: Press your thumb and middle finger together. On other hand, lock your other thumb and middle finger with first one by doing the same, so your thumbs and middle fingers now form 2 circles and without releasing your thumb and middle finger on either hand, your hands are stuck together. Now because these two rings are connected by your hands, arms and chest, you actually have topologically equivalent situation to the starting position there.(If you're re-reading this because you think you found an error, instead of thinking chest as the connecting piece, lock your elbows together so you get smaller loop) What this morphing she described does, can be explained by simply this: Connect your elbows and wrists, pull your thumbs, sort-of trying to break free from their interlocked status. You now notice that you have managed to smoothly join your hands together and form the exact same shape as in the video.
@t.e.d
@t.e.d 7 лет назад
Hey thanks for your reply! And yeah i see it now. I suppose you can straighten out the thicker curve and then shrink it so that the two rings are touching where the thicker curve connected them.
@subh1
@subh1 7 лет назад
I don't see any hole being glued in that part of the video. It's the inflating the tube-shaped connector into a sphere shape.
@Nothing_serious
@Nothing_serious 7 лет назад
It was not glued. It's still hollowed but the radius of the hole is small.
@sammerpuran8560
@sammerpuran8560 7 лет назад
Why are they only 2 holes ? I see 3 holes in the arrangement... What exactly is defined as hole and what not ?
@denzg4363
@denzg4363 7 лет назад
I so love topology, it is just mindblowing on the simplest things :))))
7 лет назад
And despite all that topological pant action scenes, still not a single hair moved.
@Ggdivhjkjl
@Ggdivhjkjl 5 лет назад
Why would anyone want to hang a picture using two nails so that if either breaks the picture falls? Half the point of using two nails is so that if one fails there'll still be something holding the picture on the wall until it can be fixed.
@KeyMan137
@KeyMan137 7 лет назад
12:34 Haha, awesome. Both of those challenge winners totally deserved it. Great submissions!
@kennytheripper2526
@kennytheripper2526 Год назад
I'm in 10th grade and I prepared a project on Topology just a day before the Science Project Exhibition. I explained it in such a way, so much mathematical way that even the research scientist failed to understand it.
@lukeinvictus
@lukeinvictus 7 лет назад
I was thinking to just nail one of the nails in deeper into the wall so the head of the nail is under the second one (because you put em close n shit), so when you take it out, the other one comes out without you doing anything :P
@anon6514
@anon6514 7 лет назад
I have lived in a 3D space for my entire life but topology never fails to confuse me.
@alexkrr
@alexkrr 3 года назад
Amazing format for explaining a complex part of mathematics (and one of the most beautiful ones).
@HebaruSan
@HebaruSan 7 лет назад
For the interlinked rings and the double donut, you can also start by shrinking the big loop until it's just a short conduit between the rings; for convenience, you can rotate the rings to put the conduit at a point where the circles cross visually in the illustration. Then it's just a matter of straightening out the rings so they point in opposite directions.
@HebaruSan
@HebaruSan 7 лет назад
For the pants, I first pulled the waist down to my ankles, then pulled the ankles up to my thighs; this turns the pants inside-out, but now they're upside-down. However, since they're topological pants, this is easy to fix! Your legs and the planet you're standing on form a ring shape like a donut; just rotate the pants around that ring till they're right side up! First the entire Earth goes through one leg, then your upper body goes through the other leg.
@rkpetry
@rkpetry 7 лет назад
[05:22] how do you contract a circle to a point-without condensing its finite interior → 0 (you'd be able to do 'most-anything' by merging 0-width-points and expanding them out).
@zairaner1489
@zairaner1489 7 лет назад
Theres no reason you shouldn't be allowed to do that
@romajimamulo
@romajimamulo 7 лет назад
Well, it never actually gets to the point stage. It just approaches it
@gJonii
@gJonii 7 лет назад
I don't know if this is helpful, but I'll try: The intuition behind those loops is that they start somewhere on the surface of the shape. It could be any point really, but let's mark that point with X. The idea is that, through point X, you feed loop, so that you hold both ends of the rope, then from your hands, each end of the rope connect to the point X, and then they go doing loop things on the surface of that shape. And the intuition with that circle shrinking away is that for sphere, I can simply pull both ends of the string and take the rope back to me. But in case of Donut shape, it forms a loop, so I can't pull it back without letting go from one end or the other(which isn't allowed). The rules are that, I can move the point X around freely(there are some rather mild restrictions to this in some edge cases, but for purposes of this video, it's completely free decision on your part where the point X is). I can also pull both ends of the rope, or give more rope, but I can never let go of either end of the rope. If given these rules, I manage to go from one loop to another, then these loops are considered the same. So in case of sphere, every loop can be made into "rope completely pulled back in", and every loop can likewise made from "rope pulled back in" position by releasing some rope, so every loop is the same. In donut case, you can see how there are different kinds of loops which we cannot make into one another. Like, no matter how much you pull or release the rope, two loops and one loop can't be made into one another.
@ori4632
@ori4632 7 лет назад
Romaji, it does get to 0. Consider the map f(r, t) =(r*cos(t), r*sin(t)) for r between zero and one, and t measuring the angle. For r>0 this is a circle, but for r=0, f(0,t)=(0*cos(t), 0*sin(t))=(0,0) so is just a point, regardless of the angle t. This is is an example of a homotopy between two maps.
@Q_20
@Q_20 7 лет назад
Why do you allow sewing holes in 2 dimensions like that but not in 3 dimensions? Inconsistent argument.
@postmachine
@postmachine 7 лет назад
i can do this with regular pants/jeans, turn them inside out, but in the end they lose some of their purpose. you pull down the upper part, then pull the insides of your legs up to your waist. now you still "wear" your pants but they are inside out, without lifting a foot.
@JohnathanGross
@JohnathanGross 7 лет назад
There was a proof I saw somewhere that for any series that diverges to infinity, there is a sequence that diverges slower. There is similarly a proof that for any convergent series, there is a series that converges slower.
@chaosjoerg9811
@chaosjoerg9811 Год назад
Without pushing together any prexisting holes 1:01 -> Now inflate the main loop bigger and bigger until it looks like a ball. 3:12
@rkpetry
@rkpetry 7 лет назад
1. yes but not in public-slide one pant over your body and bring the other pant back; 2. and do the hokey-pokey and turn yourself about-that's what topology is all about; 3. if you require using the waist opening, slide the pant over the whole Earth instead.
@PopeGoliath
@PopeGoliath 7 лет назад
My solution to the pants problem was to turn the left.leg/Earth/right.leg loop into a torus. The pants became a toroidal sheath with a hole in it. I then stretched the hole all the way over both toroid and sheathe. Inside out pants!
@MooImABunny
@MooImABunny 7 лет назад
the question about border between finite and infinite series, well, you can distort the sequence 1/n into 1/n², but the obvious one is to let the power change continuously. what I'm going at is the zeta function = 1 + 1/2^s + 1/3^s + ... if this is what we choose, then actually s = 1 the harmonic series *is* the edge. because choosing any power slightly larger than 1 gives us a finite sum, and from 1 and below the series diverges to infinity. (for values less than 1 or 1+imaginary part, zeta is no longer defined as the series)
@benreymamou
@benreymamou 3 года назад
Beautiful and smart, nature should make lots of copies of u
@sarojpandeya9762
@sarojpandeya9762 6 лет назад
Thank you very much to you and youtube.
@pierreabbat6157
@pierreabbat6157 7 лет назад
Here's how I'd hang the picture from two nails: Run the string clockwise over the left nail, then counterclockwise around the right nail, then counterclockwise around the left nail, then clockwise over the right nail. This is a 3-strand braid with two strands stretched straight and turned into nails. It's also symmetric.
@dcs_0
@dcs_0 7 лет назад
5:36 anyone else notice the reference to pbs space time? :)
@nochjemand
@nochjemand 7 лет назад
you mean besides everyone?
@dcs_0
@dcs_0 7 лет назад
naturally xD
@dexterrity
@dexterrity 7 лет назад
Anyone else think Matt is really attractive?
@seraphik
@seraphik 7 лет назад
I'm seriously starting to ship these two.
@RalphDratman
@RalphDratman 7 лет назад
It is a highly corrosive substance. Our bodies are slowly burning from the inside out. Why else would we be giving off so much heat?
@stevenzheng5459
@stevenzheng5459 2 года назад
Topology; studying surfaces in reference to holes Bottomology; studying holes in reference to surfaces
@whatno5090
@whatno5090 5 лет назад
That question at the beginning is just how I greet people
@MiMaiMix
@MiMaiMix 7 лет назад
When Kennedy said, "I'm a doughnut" he reminded that (wo)man's digestive system is like the hole in a doughnut, that we are topologically equivalent. Come to Berlin and run Axel Flinth's lecture!
@MiMaiMix
@MiMaiMix 7 лет назад
As regards turning pants inside out, it'd be more practical to turn the knickers from time to time...
@leocelente
@leocelente 7 лет назад
I would totally use those pants. I would be constantly be flipping them just to mess with people
@RickyLi
@RickyLi 7 лет назад
The pants thing was awesome.
@mal2ksc
@mal2ksc 7 лет назад
The simplest case I can think of is a sphere and a bowl being topologically identical. If you've ever handled a ball that is completely deflated so that it collapses in on itself, it forms a bowl shape. Add air, and it takes on a familiar sphere shape (at least approximately).
@johnharris9041
@johnharris9041 7 лет назад
The big ring with two connecting loops appears to have the big ring hole glued together into a big ball to make the 8 shape.
@guardianofthegalaxy2051
@guardianofthegalaxy2051 2 года назад
1:00 you cant close the hole into a full ball 3:12 close the hole into a full ball
@pallavbakshi612
@pallavbakshi612 7 лет назад
Your hair-style perfectly explains topology.... Loved the vid :D
@rockbumpproductions3409
@rockbumpproductions3409 6 лет назад
Ive only watched about 2 videos of yours and i am addicted to this!
@jsmunroe
@jsmunroe 7 лет назад
When iterating ƒ(x) = x² + c with certain real values of c, the number will bounce around infinitely between 2 and -2 never coming back to the same value. I just love that. ^_^ This is very strongly related to the Mandelbrot set.
@Weretyu7777
@Weretyu7777 6 лет назад
12:47 "And they're being attacked by Pokemon". Thank you, Kelsey.
@douglaswilliams8336
@douglaswilliams8336 6 лет назад
Great session. Im terrible at all arithmetic disciplines,but I enjoy watching. Love the pants. Quite flattering. The colours well matched the form. I'll keep watching until I start to understand.
@empty_user6159
@empty_user6159 7 лет назад
That reminds me of a part of topology called Non-Orientable Manifolds, and it specifically reminds me of möbius loops. You can connect two möbius loops (one left-handed and one right-handed), each one having only one edge, and the combination of them will produce a shape that requires four spatial dimensions to exist called a Klein Bottle. It has no edges and only one side. In three spatial dimensions it intersects with itself in a given location, but in a fourth spatial dimension this never happens.
@ayeariola
@ayeariola 4 года назад
A pretzel and a bottomless cup with two handles.
@jesusthroughmary
@jesusthroughmary 7 лет назад
If you take the 1/n in the harmonic series, and raise the n to any power greater than 1, even if it is only 1 plus an arbitrarily small epsilon, then the resulting series is convergent.
@saeklin
@saeklin 6 лет назад
Pfft, Mr Bean has you beat. He changed out his underwear for swim trunks without taking off his pants.
@daanscatozza
@daanscatozza 7 лет назад
i actually really like the picture in the picture frame.
@NathanTAK
@NathanTAK 7 лет назад
Actual thoughts while watching this video: "So Topology is Sparrow Physics?" Don't ask.
@KazeNoHibiki
@KazeNoHibiki 7 лет назад
Fun stuff, I just finished BS in Math a few weeks ago and my last math course was an independent study in Algebraic Topology! Are you familiar with the recent research in Homotopy Type Theory? Essentially, you apply the intuition of topology to the notions of term and type. Types are recognized as spaces in the same sense as a topological space, and terms with a certain type are regarded as points in those spaces. For example, the natural numbers are points in the space Nat. Under this scheme, equality of terms (a=b) is a path between terms (a path starting at a and ending at b). Also regarding the question about the harmonic series, I'm reminded of the Kempner series: basically, if you remove terms from the harmonic series which contain any particular string of digits in the denominator in any particular base (originally, any term in base-10 containing a "9") the series converges. Given this and the incredibly slow rate at which the harmonic series diverges to infinity, it's always felt to me like the harmonic series itself exists on a sort of cusp between divergence and convergence, at least in the traditional (non p-adic) sense of convergence.
@MrChief101
@MrChief101 6 лет назад
I remember a pictorial essay in Esquire mag about prisoners figuring out a way to take their pants off while wearing ankle shackles. They did pick up their feet!
@jamescampbell-gray3203
@jamescampbell-gray3203 2 года назад
So I tried taking off underwear without lifting my feet from the floor. I suddenly need new underwear, and I have an increased appreciation for thought experiments... 😂
@50iraqidinar
@50iraqidinar 3 года назад
Mathematics: Teaching us worse ways to hang a picture frame
@sk8rdman
@sk8rdman 6 лет назад
I figured I could just drop my pants, and then pull both legs up through the waist until they're inside out. You never said I had to be wearing the pants. Only that they had to end up inside out, and I couldn't move my feet.
@abramthiessen8749
@abramthiessen8749 7 лет назад
If the person wearing the pants were infinitely tall but the earth was still considered finite, you could still turn the pants inside out if you can pull it around the world.
@keineangabe8993
@keineangabe8993 7 лет назад
Another answer to the second question asked at the end: If a_n is a positive sequence whose series diverges to infinity, then there is always an asymptotically smaller sequence b_n which still diverges. By asymptotically smaller, i mean that b_n/a_n -> 0. The same is true for convergent series just in the other direction. This shows that there isn't really any edge for these things.
@Quique12
@Quique12 7 лет назад
Another good answer to the question about the edge of infinity (regarding the sums, 1+1/2+... and 1+1/4 + 1/9+ ...) is the following: The sum of 1/n diverges. But 1/n^2 converges. The sum of 1/nlog n diverges. But the sum of 1/(n log^2 n) converges. The sum of 1/ (n log n loglogn) diverges. But the sum of 1/ (n log n (loglog n)^2) converges, and so on. So if you take the product n times log n times loglog n times logloglog n times ... loglog...n (k times). The sum of its reciprocals diverges. But if you square the last term, it converges. So the edge is sort of n log n loglogn logloglog n ....
@hawknestsreach958
@hawknestsreach958 7 лет назад
wait! doesn't 3:11 inflating glue it together, because the inflation would cause an overlap at the top and make it glue together.
@rilentles7134
@rilentles7134 3 года назад
0:06 Yes! Don't wear the pants while turning them inide out!
@yqisq6966
@yqisq6966 7 лет назад
So wearing my underwear inside out has no topological difference... nice!
@nooneofinterest234
@nooneofinterest234 7 лет назад
at 3:20 you basically erased the hole of that donut, but didn't you said at the beginning of the video that an object cannot be of topology if you erase the hole in the middle?
@nochjemand
@nochjemand 7 лет назад
there is no donut.. was discussed here, get your thumbs and index fingers together and get your hands together. Are you a donut? no
@David_Last_Name
@David_Last_Name 7 лет назад
+nooneofinterest I That one tricked me too at first, but then I noticed that the large hole in the middle isn't really a hole. The 2 ends of the loop aren't actually connected, so technically that "hole" is just a loop.
@IanKjos
@IanKjos 7 лет назад
Genus Various: M. C. Escher's wood block prints included several in which the subject was two intertwined, but completely disconnected, worlds. Typically they would have different themes, such as light and dark or summer and winter. Anyway, both those worlds and the negative space surrounding them have so many holes, and (what is perhaps more interesting) they are quite constrained from any meaningful simplification without unacceptable crossing of boundaries. So that's my example, and it's weird like Escher.
@hugoguzman4985
@hugoguzman4985 5 лет назад
omg that fanart of Matt and Kelsey, tho lmaooooooooo
@GradyBroyles
@GradyBroyles 6 лет назад
Hi! I loved this video. Back in the day, I couch surfed in the home of a UC Berkeley mathematician at the time when Grisha Perelman announced his proof of the Poincare Conjecture. It was all "yeah, we'll see" at the time. What ever became of it? I remember a hastily called meeting at the Uni.
@kaylag5043
@kaylag5043 3 года назад
0:05 You don't need stretchy pants, you could do that with jeans. They're be on the floor rather than on you, but it's possible.
@zeeshannawazbaloch8211
@zeeshannawazbaloch8211 5 лет назад
best book for topology
@thesuccessfulone
@thesuccessfulone 7 лет назад
I love this. Because I am highly interested in the topology of the universe, and the other fields that are around us must also have topologies and would be mind annihilating to keep in 3D, probably.
@cassiemartin-smith2015
@cassiemartin-smith2015 4 года назад
You can turn a horshoe into a button! And vice versa!!! I solved a math problem good job brain! I want those pants!!!
@andrewlang3903
@andrewlang3903 2 года назад
8:51 a torus with a hole in it and a pair of pants
@GreydonIselmoe
@GreydonIselmoe 7 лет назад
The shapes of a can of Coke and a glass of water are equivalent :3 am I doing it right?
@haflam.
@haflam. 7 лет назад
Greydon Iselmoe you are as long as the can is opened.
@Achrononmaster
@Achrononmaster 6 лет назад
A bit late, just saw your 11 May 2017 episode. Here are two 4D (or perhaps 11D?) topological shapes with unknown topological complexity which I am pretty certain are topologically equivalent, at least on a coarse grain scale. 1. The entire universe right now. 2. The entire universe ... just now. "Sketch Proof": Use the laws of physics time cobordism to deform one into the other, assuming a scale at which smoothness assumptions of general relativity apply and that no new Black Hole singularity was created in the intervening seconds.
@IlTrojo
@IlTrojo 5 лет назад
For the first time, today I noticed that the picture hanging from two nails depicts Kelsey herself and Matt from SpaceTime!
@mathyoooo2
@mathyoooo2 7 лет назад
That framed picture is amazing
@JP-re3bc
@JP-re3bc 7 лет назад
Loved the pants turning out. :)
@depressedguy9467
@depressedguy9467 3 года назад
Where did you bought this pant
@venkateshbabu5623
@venkateshbabu5623 5 лет назад
Frequency merge gives topology. To remember topology know the frequency numbers. More than three is beyond scope of universe.
@trulyUnAssuming
@trulyUnAssuming 7 лет назад
Regarding the 1/n versus 1/n^2 series - actually the harmonic series is already the border. As the sum over 1/n^a is converging for any a>1. You can see that by bounding the sum (which is basically blocks of width 1 and hight ... well the number in the sum) with the integral over 1/n^a from 1 to infinity and get that this is convergent. So the sum has to be convergent aswell. (You might have to chop of the first summand to get the bound, but that doesn't change convergence). So I am actually not sure why you went away from this to the geometric series.
@SupLuiKir
@SupLuiKir 7 лет назад
Superglue your shoes to the floor; While this step isn't strictly required, it helps for proving the authenticity of the solution. Saw circles into the floor around where your shoes are attached. Pop out the pieces of floor and pull the legs through past each respective wooden circle. Now that the pants are separated from your body, turn them inside out. Then slide your feet out of the shoes and put the pants back on. Now pay thousands of dollars to fix your floor.
@fossilfighters101
@fossilfighters101 7 лет назад
+
@ffhashimi
@ffhashimi 7 лет назад
I like this smart woman!
@Bix12
@Bix12 7 лет назад
As long as your head isn't against a surface (like your feet are), it can be done.
@Dany1boy1
@Dany1boy1 7 лет назад
I can use a balloon and turn it into many things, then turn it back into its normal shape. lol
@titan9706
@titan9706 7 лет назад
when somebody asks you whats your favorite food and you dont want to make yourself look fat so you say "I like tori"
@titan9706
@titan9706 7 лет назад
look it up if you dont get it
@sycration
@sycration 7 лет назад
pun_resistance.exe has stopped working
@nonexistence5135
@nonexistence5135 7 лет назад
You know that satisfying moment when you actually use the think break to your advantage and end up getting the right answer? (I got the one at 6:13)
@JanboelPe
@JanboelPe 7 лет назад
A human is a coffee mug or a torus if you strech it enough. No explanation because I do not want to disturb anyone.
Далее
The Devil's Staircase | Infinite Series
13:34
Просмотров 266 тыс.
Cleaning🤣 #shorts #トイキッズ
00:18
Просмотров 8 млн
Самый БОЛЬШОЙ iPhone в МИРЕ!
00:52
Kill the Mathematical Hydra | Infinite Series
14:29
Просмотров 285 тыс.
Telling Time on a Torus | Infinite Series
10:31
Просмотров 102 тыс.
Intro to Topology
3:48
Просмотров 259 тыс.
How Infinity Explains the Finite | Infinite Series
11:47