Тёмный

Tucker COPES About FBI Raid on Trump. 

HasanAbi
Подписаться 1,4 млн
Просмотров 363 тыс.
50% 1

Tucker Carlson is now an anarchist.
Live everyday at / hasanabi
Edited by: Wargur ( / archb98 )
Other Links
TikTok: / hasandpiker
Twitter: / hasanthehun
Instagram: / hasandpiker
Check out the gaming channel - / @hasanabigaming
Art by - Jokrel/Jokerbostain ( / jokerbostain )

Опубликовано:

 

12 окт 2024

Поделиться:

Ссылка:

Скачать:

Готовим ссылку...

Добавить в:

Мой плейлист
Посмотреть позже
Комментарии : 859   
@Leonaza7
@Leonaza7 2 года назад
It's weird that such an honest and honorable man like Donald Trump keeps inexplicably surrounding himself with criminals.
@ragealien00
@ragealien00 2 года назад
Ah yeah i truly wonder 💀💀
@taliaa-444
@taliaa-444 2 года назад
ikr it’s honestly crazy to me… who would’ve ever thought??? 😭
@matthew_thefallen
@matthew_thefallen 2 года назад
yeah how odd lmao
@imrankh68
@imrankh68 2 года назад
Just a coincidence. It just keeps on happening, I wonder why?
@Ryw316
@Ryw316 2 года назад
"I'm totally innocent, believe me!"
@pyrrhus2714
@pyrrhus2714 2 года назад
Tucker: Gets mad at whistle blowers Also Tucker: We should declassify everything
@maxl2778
@maxl2778 2 года назад
@Spaceboy Because they don’t actually have any legitimate standpoints, their logic is “I am logical” therefore “everything I think is logical”. They are Textbook definitions of idiots
@LunalovaniaGaming
@LunalovaniaGaming 2 года назад
​@Spaceboy yeah, as long as they are the ones who come out on top and end up winning, they will contradict everything and anything depending on what's going on at the time. They heavily rely on the "If we use time to our advantage and wait in between situations, a lot of citizens will forget what happened and what was said, and then we can move onto business as usual" like it's their lifeline.
@charlesvan13
@charlesvan13 2 года назад
What happened to the left, that they're now fans of the FBI and state secrecy?
@gsiicam
@gsiicam 2 года назад
Documents are not nuclear lol That’s what they have to say to the public to keep the documents secret The docs hold information on very advanced new secret weapons Also 911 evidence of involvement Why do u think they took out aymen with a previously secret weapon? Because it’s not secret anymore And all witnesses had to be deleted.
@charlesvan13
@charlesvan13 2 года назад
@@gsiicam There's no evidence of that. The "nuclear documents" was a BS leak by the DOJ. The itemization of the raid said nothing about "nuclear" For one thing, technical documents wouldn't be in the White House. Documents on weapons technology is in government laboratories, eg Los Alamos.
@the_b_emoji
@the_b_emoji 2 года назад
Remember this, Fox's lawyers argued their show shouldn't be taken seriously. "Fox persuasively argues, that given Mr. Carlson's reputation, any reasonable viewer 'arrive[s] with an appropriate amount of skepticism' about the statement he makes."
@robertwinslade3104
@robertwinslade3104 2 года назад
What makes it worse is that this argument actually WORKED 🤦‍♂️
@sir-reynauld-the-kleptomaniac
@sir-reynauld-the-kleptomaniac 2 года назад
Exactly…
@DietersYT
@DietersYT 2 года назад
Therefore Tucker can say nothing true, ever. Seems logical.
@robertwinslade3104
@robertwinslade3104 2 года назад
@Meghan M. The fact that they slipped in the caveat about "reasonable viewers" just shows that even Fox's own lawyers assume that nobody unironically watching Fox News is reasonable 😂
@solhigh1
@solhigh1 2 года назад
What is scary though is that the MAGAs still believe this fool, very sad.
@ricksamericana749
@ricksamericana749 2 года назад
I'll give Tucker this much, he sure understands the intelligence level of his audience.
@DietersYT
@DietersYT 2 года назад
Says the Hasan viewer
@thepoo1234
@thepoo1234 2 года назад
I guess that's why he talks to them like they're 4 years old.
@vytalman
@vytalman 2 года назад
@@DietersYT lol aww. Butt hurt because your daddy and his viewers like you were insulted?
@ellamayothethird906
@ellamayothethird906 2 года назад
@@DietersYT found the cucker carlson stan
@thefakefloyd
@thefakefloyd 2 года назад
@@DietersYT got 'em
@WackyJack322
@WackyJack322 2 года назад
Tucker's whole response to Trump stealing Nuclear Secrets is just "Yes, and?"
@sprig5173
@sprig5173 2 года назад
But he used his "incredulous" voice so...
@Riley_Christian
@Riley_Christian 2 года назад
I love how he defends trump no matter how bad it gets. It's like on the same level of showing a child Video footage of them taking the cookie from the cookie jar, and their just like "wasn't me"
@maybemablemaples2144
@maybemablemaples2144 2 года назад
@@Riley_Christian yeah but even kids know when the jig is up. Carlson just keeps trying to square a circle.
@Primus-ue4th
@Primus-ue4th 2 года назад
Would you get mad at trump if he wanted to arm Iran with nukes?
@_-_sinexus_-_
@_-_sinexus_-_ 2 года назад
@@jwade5679 No, it is did you even listen? Or does the Tucker D just taste that good?
@razor8191
@razor8191 2 года назад
The gaslighting, damage control, and cope dished out by Tucker Carlson is aneurysm inducing.
@JFDavis-lq1bp
@JFDavis-lq1bp 2 года назад
I can't always take it. Sometimes I have to click away. I don't wanna break my tv/monitor/smartphone. Also...I was the 69th like on here. Nice
@purrsuasively
@purrsuasively 2 года назад
@@JFDavis-lq1bp nice
@3lluminatiii
@3lluminatiii 2 года назад
Jesus. Yes, you said it all. I'm shocked you boiled it down to a sentence.
@sandy120
@sandy120 2 года назад
Tucker Carlson is aneurysm inducing.
@chris4231
@chris4231 2 года назад
As if CNN or Twitter bubble were any better
@AthenaGate
@AthenaGate 2 года назад
I agree, Imagine being so corrupt that a corrupt system is worried about your existence.
@C0LD_P1ZZA
@C0LD_P1ZZA 2 года назад
To be clear, the recipe for invisible ink wasn't classified. The protocols in which our intelligence assets corresponded with invisible ink and the codes/ciphers were classified. They were basically rendered obsolete once end to end encryption became a thing.
@MaryamofShomal
@MaryamofShomal 2 года назад
Moreover, invisible ink won’t cause a nuclear holocaust
@C0LD_P1ZZA
@C0LD_P1ZZA 2 года назад
@@MaryamofShomal I mean, there was a time
@hasanabireactionsclips
@hasanabireactionsclips 2 года назад
@@C0LD_P1ZZA Glad to see this. There is completely a reason that the information regarding the use of, formula, as you stated ciphers, and other relevant information was classified. People think that because you can "buy it at any magic store now" that there was never a time when serious, influential matters were being transmitted through invisible ink notes.
@tylerhackner9731
@tylerhackner9731 2 года назад
Right wing cope never ends and I love it
@Thed538dhsk
@Thed538dhsk 2 года назад
But isn't their also liberal cope right now too? It's odd seeing allies with police reform and defund the police now defend the fbi which has been a white supremacists organization against the civil rights and betterment of minorities and working class people in this nation for a while. Feels like the right and libs switch sides every few months I guess to keep things fresh.
@SonicTheo
@SonicTheo 2 года назад
it will never end
@nunyabusiness3666
@nunyabusiness3666 2 года назад
I'm right wing. Tell me again how men can get pregnant? How the lock downs were good? How 17 shots helped everyone? How millions of illegals somehow help our poor? How drag shows for kids are great? How blm can riot for 3yrs but Jan 6 was worse than peal harbor? How Hunter can lie on gun background form and Hillary can scrub 33k emails smash hard drives but Trump is a criminal? Plus tell me how I can only be for a smaller government but somehow nut jobs like you can call me evil and want me in prison? I poke my head in and look at the hypocrisy you morons spew and honestly laugh at you. You claim to be so enlightened but really you're just losers who hate everything and everyone. I'd say seek help but you people never leave your bubble. That's why you never realize what a minority you really are.
@cvetomirgeorgiev9106
@cvetomirgeorgiev9106 2 года назад
8:27 no one bothered to explain the state secrets. Yes Tucker, I think that is what was to be expected
@chaotickreg7024
@chaotickreg7024 2 года назад
They need to just read the declassified papers live on tv
@apollo1573
@apollo1573 2 года назад
He can’t even understand the concept of a secret. Orrrrr he does and is just a propagandist
@electrified0
@electrified0 2 года назад
I love when a Republican establishment careerist who's been a Republican their entire career, continues to endorse Republican ideas, gets appointed to office by Trump, then refuse to violate the law on his behalf, they're immediately "the left" according to people like Tucker.
@LogicGated
@LogicGated 2 года назад
Tucker really said that nukes fell off so just declassify all the documents.
@maybemablemaples2144
@maybemablemaples2144 2 года назад
L+Ratio+Ufelloff+nukesstolemyjob+MAGA
@gaiusjuliuspleaser
@gaiusjuliuspleaser 2 года назад
Declassify and send to Tehran, post haste!
@InfernoYeet
@InfernoYeet 2 года назад
Congrats on a million, glad you see the left is getting bigger on RU-vid, looking at channels with millions of views filled with people hating on marginalized people is kinda depressing, thank God good people still exist.
@sprig5173
@sprig5173 2 года назад
Tommy Campbell is very funny.☮️
@purrsuasively
@purrsuasively 2 года назад
How long has he been at a mil? I’m new here 😂
@InfernoYeet
@InfernoYeet 2 года назад
@@purrsuasively A couple of days at most, he's been growing fast
@purrsuasively
@purrsuasively 2 года назад
@@InfernoYeet Daaayum big congrats in honor then tbh
@kobinho1917
@kobinho1917 2 года назад
He’s not a leftist 🤓
@a_random_voice_in_the_void
@a_random_voice_in_the_void 2 года назад
Tucker’s favorite weapon of choice: A sequence of unanswered questions, framed to induce skepticism in his uncritical audience.
@spacecase8888
@spacecase8888 2 года назад
His questions all have answers, none of them that he would like.
@ObsidianLife
@ObsidianLife 2 года назад
Yes, and they like to be told that everything‘s OK… Even when it isn’t. I’ve literally had idiot conservative say to me “I don’t wanna see the evidence “…they are happy to be dumb…
@lolwutno
@lolwutno 2 года назад
TS/SCI is literally "ultra classified", lmfao. I hold a clearance and that shit is not a joke. Taking pictures of the wrong pieces of equipment has landed guys in prison for decades.
@QuantumTelephone
@QuantumTelephone 2 года назад
I promise that you do not hold a clearance to ts/sci
@lolwutno
@lolwutno 2 года назад
@@QuantumTelephone Nope, didn't say I held TS, but any clearance requires you be educated on what these things are and what they mean. Even large aggregates of unclass have landed people in hot water. I'm curious what your background is that you're asserting that another person could not possibly hold a clearance.
@Doritochi
@Doritochi 2 года назад
@@lolwutno He probably didn't know that there are levels of clearance. Only reason I know is because I worked in security for a while.
@xXenjoi53Xx
@xXenjoi53Xx 2 года назад
@@QuantumTelephone A TS/SCI clearance is a lot easier to get than you think. Especially if you have a clean record and work in government in contracting.
@raimarulightning
@raimarulightning 2 года назад
@@xXenjoi53Xx It's depressingly easy in that sense
@lyssahunter1399
@lyssahunter1399 2 года назад
Why are they upset about classified documents being taken away from him? He's not the president anymore, he doesn't need access to those things. He's back to his regular life of a business man, there's absolutely no reason for him to have anything that could risk national security 😐
@Emmanuel-ig5iy
@Emmanuel-ig5iy 2 года назад
Well not president doesn’t get documents but if president yes documents, that’s it no normal life stuff just no
@lyssahunter1399
@lyssahunter1399 2 года назад
@Dusty Bottoms sure, but he doesn't need classified documents in his possession. Neither does any former president. Are you trying to argue that people that everyone should have access to all classified documents? I would agree with Hasan that I think alot could be declassified, but stuff to do with national security, nuclear, etc. definitely shouldn't be available to everyone imo.
@notme8232
@notme8232 2 года назад
@@lyssahunter1399 For all we know, he could have been looking for a buyer for the current locations and identities of all US spies
@lyssahunter1399
@lyssahunter1399 2 года назад
@Dusty Bottoms it was an honest question, I'm autistic, sometimes I ask for clarity because I take things literal. I thought you were trying to argue that because he's a former president, that he should have those documents in his possession.
@jaidenthekid6051
@jaidenthekid6051 2 года назад
@Dusty Bottoms The implications of you as a former president being allowed to keep accessing nuclear documents is absurd all by itself, though. But like, only in the cases of Trump where you could reasonably assume he'd threaten national security with them.
@laurendaryani4893
@laurendaryani4893 2 года назад
It is wrong to jail political opponents, but only if it's because they're a political opponent and nothing more. If someone committed a crime within their capacity as an elected public official, then they deserve a punishment that fits that crime. No one's above the law. It should be the same, whether it's a Clinton, a Trump, a Biden.... It should be outageous *not* to hold people in power/politics accountable for any crimes. Also, Tucker's Muppet-like impressions are so cringe.
@swarmyboyo
@swarmyboyo 2 года назад
PERFECTLY WORDED!!
@Kashloo
@Kashloo 2 года назад
I remember in elementary school asking "can the president just commit a bunch of crimes and get away with it because they're the president?" It seems like a lot of people just never asked that and assumed presidents were above the law.
@dylanmurphy9389
@dylanmurphy9389 2 года назад
Then you need arrest every president you’ve ever had.
@JimmyHey
@JimmyHey 2 года назад
My brain is ever so slowly dying while hearing that little mad manlet blabber on. 0 self awareness, hypocritical, nothing he says makes sense or has continuous logic that you can follow. One day it's "BACK THE BLUE!!!" next day when one of the blue's attacks them they'll scream "abolish the police!!!". Brraiinn issiiss dyyiyinngg heelplp
@AwesometownUSA
@AwesometownUSA 2 года назад
i really like an idea Felix brought up on CTH - you can get elected president, but you only get to serve one term, but it’s for seven years, but then as soon as you leave office you automatically get executed (for all the crimes you CERTAINLY did) haha
@samiamrg7
@samiamrg7 2 года назад
Tucker’s like “Release all the passwords and system information for all the computers at NORAD. The people have a right to know.”
@OmentheMarked
@OmentheMarked 2 года назад
He really own-goaled when he said trump supporter = white supremacist
@gaiusjuliuspleaser
@gaiusjuliuspleaser 2 года назад
Is it really an own-goal at this point, though? They're just mask-off fascists, they've just begun saying the quiet parts out loud without a hint of irony.
@DatDude0925
@DatDude0925 2 года назад
I was thinking the same thing lol. Dude fucking windmill dunked into his own basket with that one.
@pansexualdickhaver6878
@pansexualdickhaver6878 Год назад
@@gaiusjuliuspleaser I’m surprised they haven’t started throwing around hard Rs on tv atp. Full blown mask off. They’re insane
@ItsNatt09
@ItsNatt09 2 года назад
The fact that my dad takes what Tucker says as gospel is so frustrating to me
@ms.bunniesarecute2287
@ms.bunniesarecute2287 2 года назад
My dad is an idiot too
@carlosdellerer1948
@carlosdellerer1948 2 года назад
Hang in there guys!
@MaryamofShomal
@MaryamofShomal 2 года назад
Perhaps you should show him what his lawyers said under oath about what Tucker says: that no reasonable person should believe his show to be factual.
@SimpleSteve5
@SimpleSteve5 2 года назад
​@@ms.bunniesarecute2287 same
@maleriewarren1495
@maleriewarren1495 2 года назад
my step-dad... probably my dad, too, but I've been no-contact with him for years already.
@karmaplace
@karmaplace 2 года назад
All the hog reactions to Trump have been, “DEFUND THE FBI! DECLASSIFY ALL DOCUMENTS!” and then confusion when leftists like myself are like, “Do it.” 😎
@H56Nooc
@H56Nooc 2 года назад
Especially after they say something like "since when is the left a bunch of bootlickers!!1?!?11"
@ludovicusbathory1715
@ludovicusbathory1715 2 года назад
It annoys me because the same people called people crazy for wanting to defund the police.
@Doritochi
@Doritochi 2 года назад
Right, like they still think centrists are leftists. Like no sweetie, I am very happy you morons are doing my work for me. Pop off.
@pansexualdickhaver6878
@pansexualdickhaver6878 Год назад
@@ludovicusbathory1715 hypocrisy. It’s what they’re best at
@darkshadow5581
@darkshadow5581 2 года назад
I love it when the people arguing for decades in prison for grams of drugs try to justify stealing nuclear secrets. Sounds counter-intuitive until you realize that it was never about the laws themselves, it's who they target.
@OGSauceDaddy
@OGSauceDaddy 2 года назад
PREACH
@JimmyHey
@JimmyHey 2 года назад
Yes 100%. It's all only about aligning with the people that are on their side and if they aren't anymore then they'll be cast aside.
@jccouture13
@jccouture13 2 года назад
It included SCI documents inventoried in the warrant. They will not tell you the full scope of those under any condition. As they only get that type of classification if they include current methods being used by agencies to secure national security and nuclear documents. You literally can't even take these documents out of specialized and secured areas designed to protect them. They all require much more than the president just thinking or saying "It's declassified!" and that's that.
@belladonna8425
@belladonna8425 2 года назад
Definitely not releasing compartmented info. I don't think people understand the ramifications of even taking those out of the building.
@maybemablemaples2144
@maybemablemaples2144 2 года назад
@@belladonna8425 no they don't. Trump is lucky he wasn't thrown in a black site.
@jccouture13
@jccouture13 2 года назад
@@jwade5679 I never said he specifically had nuclear documents. I specified what SCI documents are, and they were in the inventory of the warrant. If you knew how to read then maybe we wouldn't be having this conversation.
@Vizardog
@Vizardog 2 года назад
@@jccouture13 They were too busy jumping at the chance to jerk off in Trump's defense, they couldn't comprehend much else. I wonder if they know a search warrant is issued to investigate someone's guilt and whether or not Trump took anything nuclear related is irrelevant to how just the warrant is. You have to clear people of guilt first. If there was concrete proof, Trump would've just been arrested. But he was just searched and if he did commit the crime, he'll be punished in time.
@Brizioss
@Brizioss 2 года назад
No one is safe under Dark Brandon's rule
@sandy120
@sandy120 2 года назад
Wait, tucker just said that "on some level, this is a news show" I thought according to his lawyers it was entirely entertainment and no reasonable person could see it as news?
@chadmcfly1299
@chadmcfly1299 2 года назад
That’s like a palm reading shop saying “on some level this is therapeutic”
@JimmyHey
@JimmyHey 2 года назад
Yeah, he's constantly being hyperbolic, melodramatic and over the top. He's NOT reporting the news. Maybe he likes to see himself that way, but what he's doing is not reporting the news. Otherwise he would maybe check his biases and only report the factual news. He's just a blabbering idiot that talks about his opinions on the internet about recent topics.
@robshelden4670
@robshelden4670 2 года назад
Does Tucker understand what a secret is….? See, if you tell a bunch of people about a specific topic, it stops being a secret…I dunno, maybe I’m confused.
@MrCancer66
@MrCancer66 2 года назад
Right. And he said something like they said these are Top secret(SCI) involving nuclear secrets, but they won't even bother to explain what these nuclear secrets might be! Holy Sh@@
@mistertester7252
@mistertester7252 2 года назад
This feels like the same argument made when a cop kills someone. Did the person have a criminal record, were they a bad person? This time it is "should the documents have even been classified in the first place?" It doesn't matter, stop trying to explain away the crime.
@nunyabusiness3666
@nunyabusiness3666 2 года назад
Didn't you get the liberal talking point? You guys suddenly love and fully trust law enforcement now. Try to keep up buddy.
@mistertester7252
@mistertester7252 2 года назад
@@nunyabusiness3666 They managed to retrieve the documents without shooting any black people, so that is already a great start. Although it it Maralago I’m not sure if they are allowed on the premises in the first place.
@nunyabusiness3666
@nunyabusiness3666 2 года назад
@@mistertester7252 Your still not following the latest talking points. Plus if you really gave a damn about black people (which you obviously don't) you would concern yourself on what's killing 99% of them. Not ranting about less than 1% who are shot by police for overwhelmingly justified reasons. The actual fact (by your now beloved FBI) contradict your moronic narrative about law enforcement and black people. Yet, you won't let that stop your virtue signaling even if it never helps a black person ever. Lol
@Vizardog
@Vizardog 2 года назад
@@nunyabusiness3666 "You guys suddenly love and fully trust law enforcement now" Like how you conservatives suddenly hate and distrust law enforcement when you've spent your entire political activism on sucking them off for every unjust killing and instance of brutality? Please use the space between your ears for something more than brick storage.
@apollo1573
@apollo1573 2 года назад
@@nunyabusiness3666 and suddenly conservatives aren’t supporting law enforcement. “Back the blue” unless their a fed i guess. What’s your point lmao
@Arkstromater
@Arkstromater 2 года назад
Imagine shouting “ support our police”until you are red in the face. And then denounce them the second something goes against your ideals
@JimmyHey
@JimmyHey 2 года назад
peak hypocrisy, just as always lmao
@Dovahkiin049
@Dovahkiin049 2 года назад
“I’m a little afraid of nukes.” As we all should be😅
@zeropointenergy777
@zeropointenergy777 2 года назад
That ink was STILL being used until recently THAT’S WHY it was still classified.
@catcatcatcatcatcatcatcatcatca
@catcatcatcatcatcatcatcatcatca 2 года назад
I like how Carlson described the attack on FBI office - that ended up, according to the attacker, with him being “taken out of internet” - as “mean tweets”. These people truly have accented the division between real life and online spaces.
@awoooga5857
@awoooga5857 2 года назад
The absolute delusion of these people. You know if anyone else got caught doing what trump did, they wouldn't be coming up with all these excuses😒
@bubbachildsupport4535
@bubbachildsupport4535 2 года назад
Bruh these same dudes would be having a field day if Obama did the same thing that trump did 😂
@Doritochi
@Doritochi 2 года назад
@@bubbachildsupport4535 They'd be trying to give Obama the death penalty 100%. Hell they'd try to give his entire team the death penalty.
@apollo1573
@apollo1573 2 года назад
@Nat Wru did you watch the video?
@dankmemes7166
@dankmemes7166 2 года назад
Look, all I’m saying is that someone needs to free the proud american patriots in the sudeten region of the former Czechoslovakian republic 😤😤😤
@jedraszektv
@jedraszektv 2 года назад
Please don't let them come to Poland
@ms.bunniesarecute2287
@ms.bunniesarecute2287 2 года назад
I love how tuckers neck folds over his collar. And I also love how his lips are thinner than pin stripes
@samthecowboy
@samthecowboy 2 года назад
Tucker became a goblin in the first couple of seconds
@HeisenbergWhite917
@HeisenbergWhite917 2 года назад
Listening to the way Tucker speaks gives me a skull splitting migraine
@somethingelse4424
@somethingelse4424 2 года назад
I get flashes of violent images in between the waves of searing pain in my head. It gets better when I stare directly into the sun for a few minutes.
@JimmyHey
@JimmyHey 2 года назад
I doonn't knooww abbouuttout yoouou, buttut myy brrain is dyinignnig hearringinginging him ttalklk.
@ghostcat5303
@ghostcat5303 2 года назад
'why did this guy have these secrets in his basement unsecured' because he's a complete idiot? Occam's razor, lads.
@Junksaint
@Junksaint 2 года назад
I'm with Tucker, declassify everything. If more guns is better, more nuclear nations would be too, right? Lol
@Prosyy
@Prosyy 2 года назад
The only thing that can beat a bad nation with a nuke is a good nation with a nuke. /s
@Thed538dhsk
@Thed538dhsk 2 года назад
No nuclear armed nation has fought another nuclear armed nation directly. Mutually Assured Destruction has prevented many direct wars between nations. Now if all nations had them we'd see if these proxy wars could still continue.
@JimmyHey
@JimmyHey 2 года назад
"nuclear nations?" My brother in arms, _every american citizen_ *constitutionally deserves* to have the god given right to have their own little fat boy in their jeans pocket WITHOUT A LICENSE, yeeeeeee yeeeeeee.
@kaisarion6668
@kaisarion6668 2 года назад
I love imagining what would happen if this was Obama. I can peer into an alternate universe and I can taste the Right's tears.
@philipp.7752
@philipp.7752 2 года назад
Pure. Fucking. Meltdown.
@DemonEyes622
@DemonEyes622 2 года назад
I'm mostly disappointed that we aren't talking about area 51 secrets instead of nuclear secrets
@somethingelse4424
@somethingelse4424 2 года назад
Big tiddy goth aliens.
@sprig5173
@sprig5173 2 года назад
If TFG had alien secrets he would've spilled them by now.
@somebodynamedkage9580
@somebodynamedkage9580 2 года назад
area 51 is more than likely just an aircraft testing ground. Nothing important. If there was seriously a base that was THAT important we would have no idea about it. The whole alien idea was just because some guy was listening in on radio communications around area 51 and the fbi played into it so he wouldnt leak anything important
@nunyabusiness3666
@nunyabusiness3666 2 года назад
That is the most honest response I've read tonight. It also shows the level of intelligence of the audience Hassan has. Very low.
@jacobballance117
@jacobballance117 2 года назад
@@nunyabusiness3666 dude you’ve got almost 70 comments on this channel, you’re a fan at this point. Welcome!
@turnmeondeadman4221
@turnmeondeadman4221 2 года назад
I want to face tucker Carlson in the octagon
@chadmcfly1299
@chadmcfly1299 2 года назад
Can it be in the wwe ring so it can be a handicapped match? Cus I’m in
@S-R-H
@S-R-H 2 года назад
Many documents are highly classified due to the "methods" used to get the information. Like, if we have some informant in Iran telling us info, we don't want that info getting out and putting the informant at risk. Carlson is such a bad-faith actor.
@TSmith-yy3cc
@TSmith-yy3cc 2 года назад
Spain's on fire, Loire's dry and yet the copium flows like... Well not water... Like mine run-off into what used to be a river....
@Aspensauce64
@Aspensauce64 2 года назад
“We now live in a country where the president uses armed men to cling to power” did you forget about jan 6 already tucky
@chadmcfly1299
@chadmcfly1299 2 года назад
Don’t forget the unmarked officers and cars used by the Trump Admin during George Floyd protests.
@Doritochi
@Doritochi 2 года назад
I mean the first president did that too like....what?
@apollo1573
@apollo1573 2 года назад
@@chadmcfly1299 doesn’t that still happen? I thought it was an FBI issue that is out of the president’s control
@FayieElphis
@FayieElphis 2 года назад
Why does Tucker think 1917 was "almost 100 years ago". Can he not do the most basic of math?
@jamesrobbins1243
@jamesrobbins1243 2 года назад
I remember back when Bill O'Reilly lost this gig and Tucker was put in there, and I thought "This weenie could never be a terror like O'Reilly was." Goddamn was I wrong.
@georgelaboogar3106
@georgelaboogar3106 2 года назад
"Donald Trump is not running for comptroller in Texas" 🤣
@sbrevoltuion5
@sbrevoltuion5 2 года назад
They classify stupid stuff, sure, but that doesn’t mean that you get to break the law
@Ntwolf1220
@Ntwolf1220 2 года назад
I love how he equates disappearing ink to a weapon that can destroy the planet
@kaitlyn3168
@kaitlyn3168 2 года назад
Of course, didn't you know that the pen is mightier than the sword? Or in this case, nuclear weapons. /s
@madnezz1961
@madnezz1961 2 года назад
Tucker is the king of the rhetorical question
@anthonynonapplicable6045
@anthonynonapplicable6045 2 года назад
I think the real missed question here is: "if tucker feels this way now why is he not fighting for Julian Assange?" All Julian did was declassify some docs.
@iheartlreoy8134
@iheartlreoy8134 2 года назад
He didn’t even do that they were leaked to him and he just reposted em
@apollo1573
@apollo1573 2 года назад
@@iheartlreoy8134 he also declassified some himself but him organizing a database of the docs is what got him into hot water
@the34zydc.64
@the34zydc.64 2 года назад
I remember hearing about the disappearing ink declassification, and this is another reason why Tucker is not in charge of declassification. The main reason things like that are classified to this day is not because of the recipe, but because at one point this was a viable method of sensitive information exchange. When that method became outdated, it was safe to declassify it. This is actually often the case with many classified documents. If people knew that the government exchanged information in this way at this time, and those people were in the business of obtaining U.S. documents, they could exhaust their options of decrypting it. While it may seem silly today, it's not like modern forms of information exchange, such as the internet, are truly secure either and it may make sense to use other means depending on the situation.
@fordsquared537
@fordsquared537 Год назад
Exactly. Its not that the invisible ink itself needed to be classified, its that information they DID want classified could've been stored in the invisible ink format by a third party.
@carllwalkerjr1682
@carllwalkerjr1682 2 года назад
What if one of the docs has information on where Tuckers’ mom is!?! Lmao
@grumpydave7329
@grumpydave7329 2 года назад
"Is there a reason the rest of us can't see them?" oh, wow... talk about living on a different planet... lol
@donxx1206
@donxx1206 2 года назад
i wanna see the top secart document too this is not fair 😭
@robbie5138
@robbie5138 2 года назад
The concept of explaining what's in secret documents cancels out the whole secret aspect.
@blackphoenixfamily8477
@blackphoenixfamily8477 2 года назад
The recipe for invisible ink was still a viable method authorized for use for communication all the way to that point. Yes, you could go to a magic shop and get it, but declassifying the recipe would have revealed that it was still a viable authorized method being used by agents when (I am guessing on this part) no other options were available.
@MaryamofShomal
@MaryamofShomal 2 года назад
Hasan’s on the money: the culture war is soooooo boring
@godfunk
@godfunk 2 года назад
“No American president has ever explicitly declared war against his own population…” So imagine if you would, Tucker. The year is 1861…
@Adam-fo1gv
@Adam-fo1gv 2 года назад
After the people pillaged Fort Sumter and declared themselves apart of a confederate.
@dylan9025
@dylan9025 2 года назад
LMAO
@itsmeJonB.
@itsmeJonB. 2 года назад
Tucker went on hiatus when we found out his text thread with Alex Jones emerged and he returned after the mar-a-lago raid, conveniently
@AstroKidLo
@AstroKidLo 2 года назад
All he has to say is “it’s not true” with no proof and his fans hold the phone up to you and say “SEE!!!”
@fordsquared537
@fordsquared537 Год назад
But but he said the same thing in a sarcastic tone!!1!!11!! Take that libtard!
@haze3319
@haze3319 2 года назад
My parents watch Tucker Carlson religiously and I will say just repeating whatever MSNBC says in a funny voice is a pretty effective counter.
@Yavin4
@Yavin4 2 года назад
So, using Tucker's logic here, Hillary Clinton was okay to have her own email server in her home, right?
@Dos_Caffeine
@Dos_Caffeine 2 года назад
Tucky's rantings have gotten more unhinged as republicans and Putin keep taking L's
@kobinho1917
@kobinho1917 2 года назад
What does Putin have to do with this lol
@Dos_Caffeine
@Dos_Caffeine 2 года назад
@@kobinho1917 it's pretty well known that Tucky is a flaming supporter of Putin and his idealistic goal of invading Ukraine, war crimes and all. That, and the Russian state media has put his show on air too.
@Dos_Caffeine
@Dos_Caffeine 2 года назад
@@kobinho1917 Also, he may or may not have had some texts with that Info wars guy sent to the J6 select committee. With the raid of their republican darling further contributing to the unhinged rhetoric.
@trappedinamerica7740
@trappedinamerica7740 2 года назад
Half of conservative arguments are just saying it in a funny voice, "nuclear secrets?!?"
@JimmyHey
@JimmyHey 2 года назад
No, no. They say it more like "NuCLeAr SeCREtS?!?!!!"
@middle_pickup
@middle_pickup 2 года назад
I do love the "repeat everything in a funny voice" strat. It's a winner.
@Sbs349
@Sbs349 2 года назад
My little sister is in the same sorority as Tucker Carlsons daughter. It takes all my energy to not argue with him at dinners during family weekends
@badbadgilead2552
@badbadgilead2552 2 года назад
bless your patience
@isaac10231
@isaac10231 2 года назад
Wait what?? That's crazy lmao. Don't stop there I wanna hear more stories lol.
@vanessavaughan
@vanessavaughan 2 года назад
Beau of the Fith Column did a really good video on this. The point is that it wasn't classified for the recipe of disappearing ink (because everyone DOES have it), but rather because it was still an approved METHOD of sending secret info. And protecting the Method protected OTHER sercret info. Things aren't always classified for the info itself, but because it might reveal how it was obtained, or other operational stuff. And that might put people at risk.
@reymariee
@reymariee 2 года назад
weird how they finally acknowledge that the criminal justice system is political and flawed..like we havent been saying that. do they really not hear themselves? i think this is what people mean when they say if a political party goes too far in one direction they end up going full circle 😂
@errynlovesshortstack
@errynlovesshortstack 2 года назад
Tucker sounds like someone is pinching is nuts under the desk. “Bring back manly men” (in Kermit voice)
@zazzyboy8592
@zazzyboy8592 2 года назад
Legit there was a guy who leaked nuclear secrets and he was sentenced to death. Shit is that secret
@northuniverse
@northuniverse 2 года назад
These Copium levels are Nuclear level!
@emm8357
@emm8357 2 года назад
“You’re not allowed to see them, EVER” - okay so if we’re never allowed to see them ever, how come we’re allowed to see the WW1 documents you just mentioned Tucker? Doesn’t that undermine your whole argument?
@diegowushu
@diegowushu 2 года назад
My man Tucker argued himself into anarchism in his efforts to run cover for Trump lmao. What a champ.
@H56Nooc
@H56Nooc 2 года назад
He should move to archapulco and wait for the cartel to nab his ass
@KyleJButcavageJr
@KyleJButcavageJr 2 года назад
Props for the on point Tucker laugh. Nailed it Hasan love the content found you from your debate with Charlie Kirk
@FLORIDAROOMJAMS
@FLORIDAROOMJAMS 2 года назад
Good stuff on your video Young Beard.
@connormac4401
@connormac4401 2 года назад
26:42 the TuckerPog got me dying haha
@MissyGail4eva
@MissyGail4eva 2 года назад
The reasoning behind why the documents remain classified for more than a century was not directly because of invisible ink itself, the formula of which had been available to the commercial market for decades; instead, it was the secrets behind the *methodology of it's acquisition* that necessitated the highest of classifications. Although the magnitude of the original subject matter, with the progression in technologies, may have become immaterial over time, the covert tactics, resources, contacts, etc. we're still relevant and/or active, and thus demanded utmost discretion.
@account-pending-deletion
@account-pending-deletion 2 года назад
Tucker Carlson taking up the position of "DECLASSIFY ALL TS/SCI DOCUMENTS IMMEDIATELY" and people still want to act like he's pro-america lmao
@PeacefulPariah
@PeacefulPariah 2 года назад
Beau from the Fifth Column explains the Invisible Ink secret and it shreds Tucker's point. It's sweet.
@pogo8050
@pogo8050 2 года назад
Beau is such a king.
@Banhammer000
@Banhammer000 2 года назад
I was hoping it said tucker got raided by the FBI, I re-read it and was disappointed.
@ragealien00
@ragealien00 2 года назад
Nah bro the most effective counter to anything is inserting T*cker C*rlson’s Dobby impression
@daniellee7871
@daniellee7871 2 года назад
You know he's big mad when he does the Scooby-Doo voice
@vrdynasty3896
@vrdynasty3896 2 года назад
The secret ink was used to transport secret notes to each other. These get declassified when there's ZERO risk to people/state secrets documents etc. Another thing is, if an agency is targeting a specific classified document then some documents are pointless to them if obtained. It's a game of shells.
@erin1569
@erin1569 2 года назад
LMAO the chatter at 13:30 "What about Hillary Clinton?" "Lock her up" "But I don't think we should do anything about it"
@ZIRNHELT86
@ZIRNHELT86 2 года назад
As long as Tucker doesn’t stop talking his head won’t explode.
@helloitsjay38
@helloitsjay38 2 года назад
Needed a drink to listen to this much tucky Carloson. Gobless y'all :)
@PLAtime365
@PLAtime365 2 года назад
'Yolo, release it" Lmao!
@Riley_Christian
@Riley_Christian 2 года назад
This brainwashing hits different 😵‍💫
@Valyssi
@Valyssi 2 года назад
Hmm I don't recall him being so lenient about mishandling even regular classified documents when it concerned Hillary's use of a private email server
@palehorse7377
@palehorse7377 2 года назад
Ever hear the Reuters leak of Hillary's assistant sec of state installing the Ukrainian prime minister yatsenyuk?
@dougfisher6017
@dougfisher6017 2 года назад
I never thought he’d become more unhinged. But..Tucker still surprises me with how much more broken he can get.
@direktive4
@direktive4 2 года назад
'no mention of what those secrets even are!' - yeah that's how secrets work, you tuckup
@dr.professor5229
@dr.professor5229 2 года назад
Carlson accusing someone else of whining is the highest level of projection I've ever seen.
@tj-s6328
@tj-s6328 2 года назад
HE'S REACTING TO SHAPES 🤣
@anjisbiggestfans7085
@anjisbiggestfans7085 2 года назад
If when they hear “white supremacist” and think they’re the ones being talked about.. says more about them than Garland lol 😂
@CJMGalaxy
@CJMGalaxy Год назад
"No one bothered to explain what these nuclear secrets are" - Tuckles, do you know what secrets are?
@matthewsteele5229
@matthewsteele5229 2 года назад
Tuck’s really out here testing the grit of his double-think campaign.
@nathanjasper512
@nathanjasper512 2 года назад
Giga Cope. It's nonsensical.... Well yeah it's Trump.
@avatardecadewho
@avatardecadewho 2 года назад
John Stewart didn't embarrass Tucky McFrozen Foods enough.
@xohan16
@xohan16 2 года назад
Why does Tucker sound like Doofenshmirtz
@emmy8526
@emmy8526 2 года назад
Also probably sweating about what’s in the Alex Jones text messages.
Далее
Why does the US spend so much on its military?
28:24
Просмотров 1,4 млн
RC Helicopter Trick
00:13
Просмотров 7 млн
Why Turkey Has Finally Had Enough of Erdogan
9:48
Просмотров 195 тыс.
How the Most Elite Spy Agency Operates
22:42
Просмотров 1,8 млн
Line Goes Up - The Problem With NFTs
2:18:23
Просмотров 15 млн
The Problem With Elon Musk
42:46
Просмотров 4,4 млн
How Right-Wing Media Ate the Republican Party
1:23:21
Просмотров 38 тыс.
How Benjamin Netanyahu Relies on Hamas
24:53
Просмотров 3,1 млн
RC Helicopter Trick
00:13
Просмотров 7 млн