What is PCR and qPCR? | PCR Animation

Подписаться 12 тыс.

Просмотров 157 тыс.

50% 1

Discover molecular biology and the Polymerase Chain Reaction (PCR). What is PCR and qPCR? PCR takes DNA, nucleotides, primers, and Taq Polymerase to make unlimited DNA. This target DNA gets seen by running it on an agarose gel in PCR or detecting it with a camera in qPCR. With qPCR probes labelled with different colours can amplify many targets per tube. PCR and qPCR get used in disease diagnosis and medical research.
An example is respiratory infections. In respiratory infections, qPCR tests can detect the viruses and bacteria present. Thus, many targets get detected in one sample using probes in qPCR.
🌏 www.clevalab.com
👉 You may also like: The Basic Principles of a Cell, • Understanding Cell Fun...
📖 This video is also a blog post with images and a PDF Summary visit: www.clevalab.com/post/pcrandqpcr
Visit the ClevaLab Channel Page for more videos: / @clevalab
✉️ Sign up to the email list to be notified of new videos: www.clevalab.com/email-subscr...
SOCIAL MEDIA LINKS
Twitter: / _clevalab
Instagram: / _clevalab
Pinterest: www.pinterest.com.au/ClevaLab
Tiktok: / clevalab
Facebook: / clevalab
CHAPTERS:
00:00 Intro | The discovery of PCR
00:18 What is a primer?
00:34 DNA amplification by PCR
01:33 Agorose Gel visualisation of amplified DNA
01:59 Discovery of Thermus aquaticus (Taq) Polymerase
02:25 The first Thermal Cycler
02:41 The first real-time PCR (qPCR) instrument | Probes
03:22 qPCR amplification plot basics
04:20 Cycle Threshold (Ct) value
05:06 Standard Curve for DNA quantitation
05:25 Multiplex PCR | More than one target in one tube
05:46 PCR and qPCR uses
05:54 Respiratory virus detection with qPCR
06:35 Ct value in Contact Tracing for COVID-19
06:50 Summary
#PCR #qPCR #ClevaLab

Опубликовано:

1 июн 2024

Ссылка:

Скачать:

Готовим ссылку...

Добавить в:

Мой плейлист

Посмотреть позже

Комментарии : 91

@alicute1661 Год назад

I found that so many articles/videos discussed the topic of PCR and QPCR in such excess that, as a beginner, I struggled to define the difference in such a way that I could understand it. Your video/s and delivery of information are commendable and I cannot thank you enough for your channel. Superb.

@ClevaLab Год назад

Thanks for your comment. 🤓 You're very welcome. I'm so happy you found it easy to understand. It's great to hear. 👍❤

@emirkaplan9844 Год назад

That was PERFECT. PERFECT. Everything. Down to the last-minute details.

@ClevaLab Год назад

I'm so glad it helped you. 👍 Thanks for your comment. 🤓

@shanebernard8232 10 месяцев назад

This video, as well as the videos on Sanger and NGS, are brilliant. This the best molecular biology content I have ever seen on RU-vid. Thank you so much, you are so great!!!

@ClevaLab 9 месяцев назад

That's so great to hear! 🤓 Thanks for taking the time to comment.👍

@shardsoforion 26 дней назад

Somehow after a week of my professor trying to explain this to us and failing, this video helped me understand it in 7 minutes.

@ClevaLab 25 дней назад

It's great to hear it helped you. 🤓 Thanks for your comment.

@manojgaddam5788 2 года назад

Thanks for designing a wonderful video. you made it easier to understand PCR for beginners.

@ClevaLab 2 года назад

Thanks for your comment. 🤓 So glad to hear the video made it easier to understand PCR. 👍

@malekmahmoud2503 Месяц назад

This is AMAZING!!!!!!! Helped summarize (in detail) a 50 minute lecture in just 7 minutes!

@ClevaLab Месяц назад

Thanks for your comment. 🤓 That's great to hear, I'm glad it helped you.

@ladyarcher172 Год назад

I seriously love your videos. Thank you

@ClevaLab Год назад

Thanks for your comment. 🤓 You're welcome, I'm glad they're helpful.

@sidratulmontaha4939 Год назад

this is such a good video. cant get a better explanation of PCR and qPCR than this video

@ClevaLab Год назад

Thanks so much for your comment. 🤓 I'm so glad you found it useful.

@dr.nguyenhuuhoackungbuou 2 года назад

Thanks for the video! many other videos on youtube but yours is easier to understand.

@ClevaLab 2 года назад

So glad you liked it, that's great to hear 👍🤓

@youssefbee8440 2 года назад

The most useful vid i’ve ever watched :)

@ClevaLab 2 года назад

Thanks for your comment. So glad you like it. 🤓

@alshaymaalthani3114 2 года назад

this is my favorite video about PCR thank you. you made it easier to understand

@ClevaLab 2 года назад

Thanks for taking the time to comment. I'm so glad it made it easier to understand. 🤓

@ppisitpayat1147 Год назад

Awesome! Thank you, this is very helpful.

@ClevaLab Год назад

You're welcome! 🤓 I'm glad you found it helpful.

@bigshotagee Год назад

This was excellent. Thanks.

@ClevaLab Год назад

Thanks for your comment. 🤓 I'm glad you liked it.

@abdullahialiyu6265 2 года назад

I recommend this video for novice in pcr

@ClevaLab 2 года назад

*Welcome to ClevaLab* - if you like the video, please give it a 👍 and subscribe so we can reach more people. Also, if you have any questions, feel free to ask in the comments. Get a *PDF Summary* of this video here: www.clevalab.com/post/pcrandqpcr.

@brightasante8719 2 года назад

Well explained

@francescabottona783 2 года назад

Helpful! Thank you!

@ClevaLab 2 года назад

Thanks for your comment. So glad you found it helpful. 🤓👍

@raghadalqurashi4912 Год назад

I really enjoyed watching this 😃

@ClevaLab Год назад

Thanks for your comment. 🤓 So glad you liked it.

@cezreycor Год назад

great video! Thanks! :)

@ClevaLab Год назад

Thanks for your comment. 🤓 So glad you enjoyed it.

@pascalwong5056 Год назад

thank you a lot; explanation with your animation is excellent and the flow ask for more......seven minutes viewing seems like 2 mins. .. thank your lots of work of animation behind for sharing knowledge🤩

@ClevaLab Год назад

I'm so glad you liked the animation and found it easy to watch and learn from. 🤓 Thanks for taking the time to comment. 👍

@johnkodhek Год назад

Thank you so much!

@ClevaLab Год назад

Thanks for your comment. 🤓 I'm glad you liked it.

@ET-gf8cq Год назад

Well done Fantastic

@ClevaLab Год назад

Thanks a lot. Glad you liked it. 🤓

@ricardowu3544 2 года назад

Please keep doing this

@ClevaLab 2 года назад

Thanks for commenting. 👍 There's another video in progress now. 🤓

@rezarezanaghibi 11 месяцев назад

Thank you!

@ClevaLab 11 месяцев назад

@rezarezanaghibi You're welcome! Thanks for taking the time to comment. 🤓

@annatomasova8477 Год назад

Amazing! ❤

@ClevaLab Год назад

Thanks so much for your comment. 😁🤓

@btskpop1930 4 месяца назад

THANKS

@ClevaLab 4 месяца назад

Thanks for your comment. 🤓 I'm glad you liked it.

@anjammajoka1210 Год назад

thanks so much for such a fantastic easy and simple explanation this makes my tomorrow paper preparation more easier🤩

@ClevaLab Год назад

You're very welcome. 🤓 I'm so glad it helped, thanks for taking the time to comment. 👍

@elliotbreman 2 месяца назад

great vid love u

@ClevaLab 2 месяца назад

Thanks for your comment. 🤓 I'm glad you like it.

@leocabrera6898 Год назад

amazing video

@ClevaLab Год назад

Thanks for your comment. 🤓 Glad you liked it.

@ahmedfathibasyounidonia5836 Год назад

Amazing

@ClevaLab Год назад

Thanks for your comment. 🤓

@electricLG 10 месяцев назад

This is an excellent PCR overview. I do have one question I was hoping you could answer. When selecting the primers for PCR, some textbooks/websites show the primers binding to the sequences flanking the DNA sequence of interest while others show the primers binding to the very beginning and end of the sequence of interest (not the flanking sequences). Can you explain the reason for this? I thought the primers always needed to bind to the "outside" of the sequence of interest?

@ClevaLab 10 месяцев назад

Thanks for your question. 🤓 It can depend on the type of PCR you're doing. If you want to clone a specific gene or part of DNA, you will design the primers outside the region of interest. However, if you're doing gene expression, you'll choose a primer within the area of interest, usually across an intron boundary in the mRNA sequence. Primer design might be a good topic for a future video!

@electricLG 10 месяцев назад

@ClevaLab So it basically depends on what application you're using the PCR for. That's kind of what I was thinking, but I wanted to ask anyway. Thank you for your response, and I think it would be great to do a video on primer design in the future!

@ntabeajohtime6301 Год назад

Very helpful.I will like a video on Abbott RealTime PCR

@ClevaLab Год назад

Thanks for your comment. 🤓 OK, I'll keep that in mind. I have more PCR-themed videos planned for the future.

@dmadhav4867 2 месяца назад

Great vedio ,it just reminds me of kinda animation of @amebasisters .

@ClevaLab 2 месяца назад

Thanks for your comment. 🤓 I choose to take that as a compliment.!

@dmadhav4867 2 месяца назад

@@ClevaLab 🙂😂

@user-tf8ys9wy8e Год назад

I have a question for qPCR. How many fluorescent atoms are in the probe repoter molcule? only one or several?

@ClevaLab Год назад

Thanks for your question. 🤓 For each DNA probe just one dye molecule is present. The most common dye is 6-FAM (Fluorescein), one 6-FAM molecule is added to each probe. To see the chemical structure see this link: en.wikipedia.org/wiki/6-Carboxyfluorescein

@maxforster0 Год назад

Thank you for that video! One question i couldn't answer myself at that point: 0:46 - Why do the primer bind to the separated DNA single strands, before the other DNA single strand? *hope that makes sense. Maybe because of the length?

@abicoid Год назад

I think primers determine the "Start" and "End" points of the segment that will be amplified. They are complementary to the target gene sequence. The separation of the DNA makes it possible for the start of transcription.

@ClevaLab Год назад

Thanks for the question. 🤓 Yes, well spotted. One primer binds first followed by the other on in my video. This was becuase it looked better! In reality, the primers will bind at different times. The time they bind depends on their annealing temperature. The annealing temperature is the temperature the primer binds to the DNA. When designing primers you aim for a 60 degree annealing temperature. But, due to differences in the sequence of the primers. They'll actually bind at a different temperature. So one may bind before the other. This differences is becuase G and C bases have stronger binding than A and T bases. So the more G and C bases in the primer the higher the annealing temp. Yes, you're correct that the primer length also changes the annealing temp. I hope I answered your question, please let me know if you have any further questions.

@maxforster0 Год назад

@@ClevaLab Sorry, but i think, you misunderstood me there, my bad. English is not my native language. But thank you for your answer. What i meant: In the PCR, at some point, you got the double stranded DNA - from the template RNA - and the primer/probe. When you heat it up for denaturation, the double stranded DNA "spreads" up into two single strands. Then, you cool it down to the annealing temperature for the primer to bind. But you still have the opposite part of the DNA single strands in the reaction. My question was meant like that: The primers match one of the separated single strands of DNA in the sample. When you got a single strand with - AAAACCCCGGGGTTTT - in the PCR, you would have a Primer, which sequence could be like AACC or something. Q: How is the primer able to bind to the opposite single strand, before the original strand, who was "spread" off just before? They share the same sequence, but one - primer - binds before the other - sequence who was denatured before - one. For example - i hope formating works: - DNA double strand: AAAACCCCGGGGTTTT TTTTGGGGCCCCAAAA - Primer: AACC When you cool it down, that the primers can bind, you have two sequences, who could possible bind to this - TTTTGGGGCCCCAAAA - sequence. It would be the primer "AACC" and the other DNA single strand "AAAACCCCGGGGTTTT". "Q: How is the primer able to bind to the opposite single strand, before the original strand, who was "spread" off just before?". Hope, that was better then my first one, sorry. 😕

@ClevaLab Год назад

OK, I see what you're asking. 🤓 The two primers in the video are not of the same sequence. For example, two primers are designed to amplify a section of the Human IL-15 gene below. The forward primer in bold is designed to bind to the reverse strand (bottom strand in the video). The reverse primer in bold is for the forward strand (top strand in the video). The direction that the bases are added depends on which end has a phosphate group. The end with no phosphate is the 3' end, and the Taq Polymerase adds bases from this end. So the Reverse Primer below will be 5'-GCACTGACCATTCCTGCAAA-3' when ordering the primer. When you design primers, you'll also ensure the sequence matches only one part of the DNA. You can check this with a program like BLASTn. With BLASTn, you can check that the forward primer (see below) will only bind to one region of IL-15. Out of the whole human DNA genome. The same for the reverse primer. I hope this helps. Please let me know if you need further explanation. *Forward Strand of IL-15 Sequence:* 5'-AAAAGGTACCGCAGCTCCCC *ACTTCCTAACTGCTCCCGTC* CCAAACTCATTGTGGGCCGGTGCAGATGTCTGTGCGTGCGCGTCTATCCCTACCTTTGCAAAATCAAATTATCGCCCTCTTCTTTGCTTGCACACGTCTTCTGGGAGAGAAA *TTTGCAGGAATGGTCAGTGC* TTGGCAGTCAGGCCTGGGTCTGTATT-3' *Forward Primer* 5'-ACTTCCTAACTGCTCCCGTC-3' *Reverse Primer* 5'-GCACTGACCATTCCTGCAAA-3' (Reverse Complement: 5'-TTTGCAGGAATGGTCAGTGC-3')

@maxforster0 Год назад

@@ClevaLab Okay ... I guess, i guided you in the wrong direction with my reference to 0:46 of your video ... Please forget about that. Let's take a very simple (without a probe or more then one primer) PCR: - DNA-sequence (only one of it in the reaction): 5' - AAACCCGGGTTT - 3' - Primer (only one of it in the reaction): 3' - TGGGC - 5' Now, after the denaturation, i would expect these sequences to be in this example PCR-reaction - really, just these 3 and nothing more: 5' - AAACCCGGGTTT - 3' / 3' - TTTGGGCCCAAA - 5' / 3' - TGGGC - 5' After cooling it down, there would be two possible sequences, who are able to bind to this (5' - AAACCCGGGTTT - 3') single strand: - the opposite DNA-strand (3' - TTTGGGCCCAAA - 5') - the primer (3' - TGGGC - 5') The possible outcome would be one of this - hope the format works: 3' - TTTGGGCCCAAA - 5' 3' - TGGGC - 5' 5' - AAACCCGGGTTT - 3' or 5' - AAACCCGGGTTT - 3' The only question, i wanted to be answered was the following: How does the primer (3' - TGGGC - 5') bind first to the sequence it matches and not the DNA-single-strand (3' - TTTGGGCCCAAA - 5') who got separated before? They both share the same sequence (TGGGC) who is able to bind to 5' - AAACCCGGGTTT - 3'. How is one "faster" then the other? I wish you a nice weekend.

@TheRealMorgs41 2 года назад

So, how do we make these very specific primers, which enable us to 'PCR' one specific gene, if we dont already know the DNA sequence? The sanger method of DNA sequencing, requires specific primers, complementary to the DNA younare trying to sequence. Well hold on a minute, thats a bit of a paradox isnt it. How do you know what the primer should look like if you dont know the sequence of DNA?

@ClevaLab 2 года назад

Thanks, good question. 🤓 The original method by Sanger to sequence PhiX174 (a bacteriophage), the first full-length sequence made, did not use primers. This was because primers were hard to generate then. Instead, they used restriction enzymes to cut DNA into fragments and used these fragments as the primers for their sequencing reaction. So, they didn't need to know the sequence as they depended on restriction sites to create the first full genome sequence. Restriction enzymes are made by bacteria as a defence against bacteriophage (a virus for bacteria). They cut up the bacteriophage DNA to restrict its ability to reproduce. This fact was used by Sanger in combination with radiolabeled nucleotides. Today, if a sequence is unknown, you can use random hexamers to amply it in a PCR or perform shot-gun or full genome sequencing without knowing any sequence. Short DNA fragments of known sequences are stuck on the ends. These known DNA fragments are then used to sequence the unknown DNA.

@TheRealMorgs41 2 года назад

@@ClevaLab Thank you

@user-pt4ri1my2r Год назад

Wow just really fixed the matter for me, thanks! Can I use the pictures for a presentation I need to show in class?

@ClevaLab Год назад

Thanks for your comment. I'm so glad it helped you. 🤓 Sure, you can find images in the blog post or even download a pdf. Find it here: www.clevalab.com/post/pcrandqpcr

@user-pt4ri1my2r Год назад

@@ClevaLab thanks!

@landcruiser6652 7 месяцев назад

Where's the 72°C for Taq polymerase?

@ClevaLab 6 месяцев назад

Thanks for your comment. 🤓 That's a fair point, I should have included it, I can't remember why I didn't!

@davidconcepcion4429 Год назад

These videos always miss a very important fact that nucleotides are free-floating around with the rest of the slurry, and are snatched up by the DNA-polymerase as they pass by in order to be used for the copying.

@ClevaLab Год назад

Thanks for your comment. 🤓 That's a fair comment. I could have made that clearer in the video and had some nucleotides floating around.

@abicoid Год назад

Why conventional PCR is qualitative and real-time PCR is quantitative? :o

@abicoid Год назад

Nice video, tho. Already subscribed. :)

@ClevaLab Год назад

Hi Abby, thanks for your question; it's a good one. Standard PCR can be semi-quantitative. We used to used this method in the lab before qPCR was available. Suppose you stop the PCR during the exponential growth phase of the samples. Then, you can compare the DNA level between samples. But, the dynamic range is tiny in comparison to qPCR. So these days, people use standard PCR for yes/no type testing. I hope this helps and answers your question. Please let me know if you have any further questions. 🤓

@ClevaLab Год назад

Thanks, so glad to have you as a subscriber. 🤓👍

@abicoid Год назад

@@ClevaLab Ohh, but in what phase in the amplification determines the "yes" or "no" answer? Is it in the plateau phase? Also, if I were to optimize a PCR reaction, is it okay if I use Agarose Gel to determine the quality of DNA result through crowning? Or I still need to use UV Vis?

@ClevaLab Год назад

Usually, around 30 cycles are used for an endpoint PCR. This amount of cycles is enough to amplify your DNA fragment. However, people don't go out to 40 cycles for end point PCR so the fragment can also get used for cloning and sequencing. Beyond 30 cycles, there is a greater chance of non-specific amplification and PCR errors. Many PCR master mixes don't need any optimisation. But you can buy PCR optimisation kits if you're doing something specific. Perform the PCR with these mixes and run the samples on an agarose gel to see the best band. There are also DNA staining products that use LEDs to see the bands. But if your lab only has Ethidium Bromide, you'll need a UV light box or imaging system. You can also run the DNA on a capillary-based gel system to see the bands if you're lucky enough to have access to one. I hope this answers your question. 🤓 Please let me know if you have any further questions.