5 Brilliant Minds Who Shaped Modern Science | Compilation

Подписаться 8 млн

Просмотров 180 тыс.

50% 1

Curious who some of the greatest scientists on Earth are, or were? These folks contributed tons of research to our understanding of the world, and in some cases saved lives along the way! Learn all about them with Rose Bear Don't Walk in this new episode of SciShow!
SciShow has a spinoff podcast! It's called SciShow Tangents. Check it out at www.scishowtangents.org
----------
Support SciShow by becoming a patron on Patreon: / scishow
----------
Huge thanks go to the following Patreon supporters for helping us keep SciShow free for everyone forever:
Marwan Hassoun, Jb Taishoff, Bd_Tmprd, Harrison Mills, Jeffrey Mckishen, James Knight, Christoph Schwanke, Jacob, Matt Curls, Sam Buck, Christopher R Boucher, Eric Jensen, Lehel Kovacs, Adam Brainard, Greg, Ash, Sam Lutfi, Piya Shedden, KatieMarie Magnone, Scott Satovsky Jr, charles george, Alex Hackman, Chris Peters, Kevin Bealer
----------
Looking for SciShow elsewhere on the internet?
Facebook: / scishow
Twitter: / scishow
Tumblr: / scishow
Instagram: / thescishow
----------
Original episodes and sources:
Great Minds: Mary Anning, "The Greatest Fossilist in the World"
• Great Minds: Mary Anni...
Great Minds: Margaret Hamilton
• Great Minds: Margaret ...
The Woman Who Changed Drug Development
• The Woman Who Changed ...
Bugs Aren't Brainless! | Great Minds: Charles Henry Turner
• Bugs Aren't Brainless!...
Alice Hamilton: The Doctor Who Made Work Safer | Great Minds
• Alice Hamilton: The Do...

Опубликовано:

29 июн 2024

Ссылка:

Скачать:

Готовим ссылку...

Добавить в:

Мой плейлист

Посмотреть позже

Комментарии : 293

@derekcouzens9483 3 года назад

"She sells sea shells by the sea shore". Yes that was about Mary Anning.

@walrus4046 3 года назад

Beat me to it Derek!

@gibranhenriquedesouza2843 3 года назад

This look like my english classes at the language school: listen and repeat "she shouldn't say swear words"

@evodolka 3 года назад

my god, now i have a reason to like that little tongue twister

@303elliott 3 года назад

It's a very fun idea! Unfortunately it has been debunked, but is pretty common misinformation nevertheless

@walrus4046 3 года назад

@@303elliott Must admit I was wondering how fossilised bones transformed into seashells. Apart from not alliterating of course lol Some witty paleontologist needs to step in and help us out here lol

@FalbertForester 3 года назад

"Unparalleled awesomeness" - a fitting description of Dr. Alice Hamilton

@MusiciansReflib 3 года назад

Hank, I just discovered your works of music composition! I didn't know you were a musician. Actually we saw your wikipedia page and our minds are blown at how much work you've taken part in.

@Aaron_Jensen 3 года назад

The great mind that I will continue to celebrate in 2020 is Grant Imahara.

@semaj_5022 3 года назад

I'm still heartbroken about his passing. Such a shock and such a massive loss.

@kloassie 3 года назад

Continue to celebrate in 2020? So starting from friday you won't celebrate it anymore?

@kayakat1869 3 года назад

A real king.

@bakedpotatogaming777 3 года назад

Omg I didn’t even know he passed...

@SoManyRandomRamblings Год назад

One of Grant's last projects was working on creating the animatronic Baby Yoda.

@catcatcatcatcatcatcatcatcatca 3 года назад

Turner: Insects are not simple machines responding to stimuli, they are rational desision makers that hold the same unique trait humans and bigger animals do! Behaviouralists some decades later: Yeah, about that cognition thingy, we are pretty sure it's just a slightly more complex machine responding to stimuli. Thanks Turner! All jokes aside, humans have learned so much by simply questioning our own bloated ego and the way we often underappreciate all other life on this planet. Saying other life is smart and saying we aren't as special as we think is just two sides of the same coin. Traditions throughout world have seen animals as wise teachers, aspirational heroes and force bigger and smarter than human throughout history. We should probably do that more often, and on the flip side, see ourselves more as animals than something divinely rased above simple rules of nature and life.

@303elliott 3 года назад

I agree with this philosophy. Good things to keep in mind

@icarusbinns3156 10 месяцев назад

I’m still gonna smash that spider… or set the cats on it

@outdoorsy01 3 года назад

I live in weymouth. The Jurassic coast as it's called. Right next to lyme regis. Fantastic place to visit

@gerardacronin334 3 года назад

I visited Lyme Regis in 2019. It’s fascinating. The museum has many large specimens of fossils unearthed by Mary Anning.

@Antenox 3 года назад

@Ontheroad13 3 года назад

I absolutely love Margret Hamilton. One of the best things is reading the code she has written. It is fascinating. Look it up on GitHub.

@ccgarciab 3 года назад

I didn't know it was uploaded! ty

@Ontheroad13 3 года назад

No problem! It’s awesome.

@IanGrams 3 года назад

If you've not already seen it, some people from Google made a neat tribute to her using mirrors from a solar power plant to depict her portrait in moonlight. blog.google/products/maps/margaret-hamilton-apollo-11-tribute/ Here's the behind the scenes video which iirc shows Margaret's reaction to seeing it: ru-vid.com/video/%D0%B2%D0%B8%D0%B4%D0%B5%D0%BE-7oprumUQddk.html

@dhampson545 3 года назад

Whenever I think of Doctors and masks- I think of Florence Nightengale. She would be an awesome topic for a show.

@bartwilson2513 3 года назад

Did my family’s genealogy and found I am related to Florence Nightingale. That was a trip. Lol.

@thedigitalodometer945 3 года назад

@@bartwilson2513 Congrats! 🥳

@Th3F0nz 3 года назад

23:05 If the cat can wear a mask, so can you.

@semaj_5022 3 года назад

Yes please continue the Great Minds series please!!! And "I Don't Think That Means What You Think It Means," while we're at it. I loved those so much.

@rohannalawade3227 3 года назад

Who else loves Rose's earings?

@chavezharding7820 3 года назад

Wow. Back then we didn't know how cells made or used nucleotides? It's incredible the strides made since that time. We now know the origins of every single carbon in purines and pyrimidines.

@lilladydeuce 2 года назад

Mary Jackson who also worked for NASA would be a very interesting subject. But I love your series on great minds. Keep to the great work. It is like being back in college many years ago.

@ryaneylee 3 года назад

Ah, back when Michael had precovid hairstyle

@necessaryevil455 3 года назад

Roughing up a moth, oh man that's so wrong. lol

@nicstroud 7 месяцев назад

Mary Anning is also said to be subject of the tongue twister, 'She sells, sea shells, on the seashore.'

@jerrysumner4923 3 года назад

Thank you for these two programs. Just what I needed after a hard day😀😀😀

@kristianminkov9631 3 года назад

Hi guys, thanks for all the great videos. I watch all of them and not only on this channel. I hope you make videos about Jacque Fresco and Buckminster Fuller some day. Two great minds worth mentioning.

@orchdork775 3 года назад

RIP TRAY 😢😭

@MxDiagnosis 3 года назад

Toast to all these people and to a better 2021! 🍻🥂

@elizabethCorkins83 3 года назад

🎉🎊🎉🎊🎉🎊🎉

@Antenox 3 года назад

@slaterrox23 3 года назад

Leaving a positive comment to dilute out the lemon heads -- Awesome video! Was so much more interesting than "5 Great Minds You Already Know About", haha. Also how good would it be to collect fossils in your backyard?? The past was wild.

@kayakat1869 3 года назад

People still do that in the Dakotas and Montana. That would be incredibly cool.

@dilpher 3 года назад

I love this channel. The content is awesome. Great job people 👏🏾👍🏽

@joost00555 Год назад

I always wish we could tell some of these outstanding scientists that have since passed how their work has impacted future science. I can only imagine how exciting that would be for them.

@gregorywhittaker1502 3 года назад

Those earrings look AMAZING!!! Please tell me that they are authentic pieces from Host Rose's heritage AND that we can anticipate an episode about them and their makers.

@KnighteMinistriez 3 года назад

Science is awesome and I love watching videos on this channel. Keep up the good work.

@evanrigel954 3 года назад

i was hoping to hear about Ada Lovelace or Dr James Barry (my personal heroes) but learning about these other awesome people in science was heckin cool too

@svenmorgenstern9506 3 года назад

How about Temple Grandin? Nah - not PC enough

@CritterKeeper01 3 года назад

Give them time, they've done other Great Mind compilations, they will likely get to your favorites, especially if you advocate for them here!

@CritterKeeper01 3 года назад

@@svenmorgenstern9506 Huh? How would including an icon of neurodiversity be *not* "PC"?

@ardenalexa94 10 месяцев назад

Some, I haven’t even heard of hardly at all before watching this video. But I’ve become addicted to this channel. 😂

@jessice293 3 года назад

Awesome compilation guys! I love the added backstory of these wonderful scientists. Thank you for shedding light on some lesser know women in STEM. I personally loved the video, and if your subscribers have a problem with that then they aren’t exactly here for the science then

@HECKproductions 3 года назад

some opressed girl 100 years ago: finds out that masks prevent the spread of disease karens today: tHiS mAkS iS oPrEsSiNg Me

@pamelamays4186 3 года назад

Nonchalant Moths. My new band name.🦋🦋🦋🦋

@reasonsvoice8554 2 года назад

23:12 the cats got a mask on too 😂

@lexfrancis5916 3 года назад

12:03 ayy that's what I take. Thanks Elion

@DominikJaniec 3 года назад

nice compilation!

@demonetizationbutton2388 3 года назад

Great video! 10/10 would 100% watch another one of these again!

@pheart2381 3 года назад

You can find tiny fossils among the sand and stones on lyme regis beach,but watch the cliffs! and the tides!!

@kylebarry8208 3 года назад

Thank you for doing this series again! I missed them so much!!!

@Antenox 3 года назад

@hollyjhager 2 месяца назад

Love this!

@eliscanfield3913 3 года назад

If there isn't an Anning-saurus and a Turner-bug of some sort by now, there most definitely should be.

@brandonzzz9924 2 года назад

1000 dollars a year as a high school teacher seemed like nothing until google let me know that the price of a house was A DOLLAR A SQUARE FOOT IN 1908

@charleshicks604 3 года назад

14:51 I would not mind if hank did them all, it would be cool seeing him years older or younger than the previous video. And I really like Hank as a host.

@seachers6124 3 года назад

Hey if you're interested I've got a few things you guys and gal's should see. #1. I figured out how to cool off a broken nuclear reactor and end the nuclear waste while protecting the rest of the planet from a growing radiation threat. #2. An "engine" i,e, thrust source that works with magnets . My engineer friend says 1,000,000lbs of vectorable thrust. Allowing a vehicle to lift any amount of weight or pick up speed ( in outer space ) exponentially. Second by second . Reach out to me and we can discuss these designs.

@marjoriebahm9239 3 года назад

Michael, you look great! Love the haircut! Finally!

@demonflowerchild 3 года назад

It was an old clip

@robhenry7896 3 года назад

R.I.P. Tray

@Jagzeplin 3 года назад

id love to know how Turner "roughed up" those moths

@robomonkey1018 3 года назад

I sort of think you wouldn't lol

@BlazeOGlory 3 года назад

He put little boxing gloves on a wasp

@renzox1136 3 года назад

Like a mafia godfather

@303elliott 3 года назад

He trained a bunch of caterpillars to wait by his car. They were taught to associate wacking a moth with lil bats to a sound track to receiving delicious leaves.

@ryancx9524 3 года назад

Nice episode

@Antenox 3 года назад

@StudyWaliClass 3 года назад

awesome

@medan880 3 года назад

I want this year to bring a cure for ME!!!

@TheJaboogie 3 года назад

RIP Doggo

@alexiswelsh5821 3 года назад

Hamilton: The Astronauts could press the wrong button and ruin everything! NASA: There’s NO WAY our highly trained astronauts would do something like that! Highly trained Astronaut: I pressed the wrong button and now we can’t get home! Hamilton: Told you so NASA: Shut up and fix the problem we wouldn’t let you prevent!

@Antenox 3 года назад

@stephenconnolly3018 2 года назад

There is a world outside America being the first America is not the same as first in the world.

@chriscostello117 3 года назад

Thanks for all the hard work and you and your team have done. I have by all means been left me with some next level gems Sound and Fury for example. Happy new year . Stay Safe and #savetheventurebros

@twocvbloke 3 года назад

Although Hank makes a lot of videos, he's got nothing on Simon Whistler, I swear that guy has multiple clones for all the videos and channels he does... :P

@sandeesandwich2180 3 года назад

I liked this, though I did feel in solidarity I should "smash that dislike button".

@thomas.02 3 года назад

how many channels does the guy even host?!

@twocvbloke 3 года назад

@@thomas.02 All the channels, allegedly... :P

@sandeesandwich2180 3 года назад

@@twocvbloke Because he's a LEGEND. Allegedly.

@jerrysumner4923 3 года назад

This program is wonderful! Top drawer👍👍👍

@sarahburke5839 2 года назад

They went to the container with the food in it??... Fn Geniuses those bees must be! !😲🤨🤔

@debkayaker 3 года назад

Love your show. Please ... No more cockroaches

@philvarney3860 3 года назад

Never mind the smart people. Who managed to get the cat to wear a mask?

@topaz0a 3 года назад

Thanks i knew about Michael Hill! He was my professor in Oxford and told us FBC fund!

@nicoleonfeels 3 года назад

Here’s to greater minds in 2021! 🥂

@Antenox 3 года назад

@mangoface4323 3 года назад

Breastfeeding shirt shoutout! 💗

@outdoorsy01 3 года назад

The worst years, shines a light on the greatest minds.

@Antenox 3 года назад

@Rei-invented 8 месяцев назад

Ive seriously considered being a entomologist and im worried about the jobs avaliable, i'm super interseted in making some living terrariums when i can afford it!

@davidpavel5017 3 года назад

Hank calling dibs on great scientists

@Xirpzy 3 года назад

Could have mentioned Wu Lien-teh as well.

@lewisgordon1490 Год назад

It was a mistake IMO to not include any of the human computers from the Hidden Figures book & movie. Esp Mary Jackson IMO who was trusted by John Glen over the mechanical computers. But possibly and/or Mary Jackson, & Dorothy Vaughan.

@Cedrus_ 3 года назад

its okay, hank is my favorite, but i love all of you

@JeevasJerico13 13 дней назад

Hmm, wonder why this video got so little traction

@minnymouse4753 3 года назад

First episode of Ozzy and Drix Scarlet fever gets in anew body from a mosquito can that really happen

@IanGrams 3 года назад

Scarlet Fever is caused by a bacteria that causes Strep Throat. As far as I could find, that doesn't seem to be a mosquito borne disease, so it seems the creators of the show took some artistic license with that story. www.health.state.mn.us/diseases/mosquitoborne/diseases.html en.wikipedia.org/wiki/Scarlet_fever

@minnymouse4753 3 года назад

@@IanGrams so the show was wrong they even had mob strep throat villain but hay its impossible for mainstream scientist to be 100% accurate with so many discoveries being made

@IanGrams 3 года назад

@@minnymouse4753 yeah it seems either they just wanted that storyline or they mixed up Scarlet Fever and Yellow Fever which is transmitted by mosquitoes. But agreed it's hard for anyone, scientist or not, to ever be 100% accurate.

@minnymouse4753 3 года назад

@@IanGrams yeah I've noticed in the series and movie many organs and diseases called some things are much more like other things. Thrax his size alone and releasing a burning substance ant taking an important chemical he's much closer to a bacterium. Then a virus

@IanGrams 3 года назад

@@minnymouse4753 agreed, they definitely focused more on a good story than an accurate one. The fact Thrax never infected any cells to make more of himself wasn't very virus-like and stealing a single nucleotide to cause issues doesn't make much sense because our cells can repair DNA damage. But at least I learned from the movie the hypothalamus regulates body temperature so there was a little truth to it 😅

@sheikhsquad9624 3 года назад

FBC fund and their algorithm is the best, there is no point in arguing with this

@darkangelprincess101 3 года назад

So how do we train roaches to avoid the dark so I can sleep at night

@lili_dee 3 года назад

Interesting that nowadays we all know about Mary Anning, but very few can name any other paleontologists of that time.

@elizabethCorkins83 3 года назад

Happy New year's everyone

@gerRule 3 года назад

Same to you

@Antenox 3 года назад

@Isha-ot6tc 3 года назад

Why don't you continue with the series 😤

@teagan_p_999 3 года назад

Great video, love the diversity and scientists I didn't know much about yet.

@jar-jar3806 3 года назад

Sometimes the content on this channel makes me emotional in a beautiful way

@Kamel419 3 года назад

i love that you highlighted only minorities in this list, but wish you had made it clear somewhere that's what you were doing. mostly because i think this would make it easier to find for those looking for such lists. i think it's amazing to see all of the wonderful accomplishments!

@CritterKeeper01 3 года назад

I'm guessing the idea is that it shouldn't be any more unusual or remarkable to see such a list with no white men in it, than it is to see one with no black women in it. Which, I notice, is a group that *noone* seems to have noticed was not represented, while quite a number of people have commented on the list not including any white men.

@Kamel419 3 года назад

@@CritterKeeper01 as admirable as your sentiments are, the statistical distribution does in fact make it an anomaly. wishing it to be otherwise doesn't make it so :(

@CritterKeeper01 3 года назад

@@Kamel419 You mean the statistical distribution of people who have *already* gotten widespread recognition for their achievements, or the statistical distribution of the actual real life people who made great discoveries, whether they got recognition at the time or not? Those are two very different things!

@tatinightmare Год назад

How do we know about Mary anning now if all of her work was published by other people and was virtually unknown 🤔🤔

@icarusbinns3156 10 месяцев назад

23:14 1918 pandemic family picture…. How did they get the mask to stay on the cat??

@elizabethCorkins83 3 года назад

I hope 2021 is better 🌹

@JudyMenzel7 2 года назад

After listening to several of your shows about bygone scientists,, mathematicians, physicists, geologists, etc, it seems to me a vast number of them died from some sort of cancer. Is there an explanation for this?

@joelmiller3218 6 месяцев назад

1 in 4 people will get cancer at some point in their life, and the older you get the odds become 1 in 2. And in the old days we didn't really have anything to treat cancer with so by getting cancer, death was almost guaranteed. Unlike today.

@renzox1136 3 года назад

So 2020...

@jessicaevans7847 3 года назад

Girl, I don't think you really have the right to joke about Hank's hosting frequency. I mean you've been around for what like two or three great minds?

@wontnotawill1356 Год назад

Margaret Hamilton was so beautiful as a young woman

@EpicGamerScout 3 года назад

Man these commenters are wild. Are you saying you would have really preferred the video simply list off 5 insanely smart but already extremely popularly known scientists, adding nothing new to most viewer's understandings? "And here's a video about Einstein, did you know he figured out how space works?!? And here's one about Steven Hawking, did you know that black holes are weird?" Scishow is in the business of showing people interesting things that they didn't already know, and scientist for scientist, the most unrecognized work is gonna tend to be from the women. It's not a grand conspiracy to exclude white men, it's just the logical conclusion of educational content aimed at giving you fresh knowledge.

@Antenox 3 года назад

+1 It's because the commenters complaining about the choices are the kind who hated science in school. That's why they think the only ones who deserve attention are the "popular" ones that a grade schooler could name.

@nikolajovanovski7481 3 года назад

based

@DrIstoris 3 года назад

Antenox not true. I think the video was named originally greatest minds. Also, the comments are shitstorm because well.. it is not diverse enough :)))

@girlgamer4444 3 года назад

The majority want their ego stroked but half have been told that it's wrong.

@unknown..66..99 Год назад

@@Antenox yeah

@a_real_jive_turkey7772 2 года назад

What if moths can't hear and instead they are feeling vibrations

@savagepro9060 Год назад

hearing is feeling vibration through the mechanics of the ear

@theaverageblitzer4351 3 года назад

Hank is a snack ngl

@itzmeB2 2 года назад

I'm proud that over 50% of the minds are women

@ryosworkshop500 3 года назад

How did we figure out the story about the fossil woman if all her discoveries were published by men

@stephanieh.777 3 года назад

Would you please do an episode about the woman behind every medicine we use today - HeLa - Henrietta Lacks. Without her immortal cells, many medical advancements would never even have left the ground...

@Antenox 3 года назад

@IanGrams 3 года назад

They did one 4 years ago: ru-vid.com/video/%D0%B2%D0%B8%D0%B4%D0%B5%D0%BE-sXY6-wLesYY.html

@valleyshrew 3 года назад

She didnt even know about it and deserves no recognition for it. They are just cells that share her dna, she didnt really contribute anything.

@patriciamcintyre1667 3 года назад

@@valleyshrew So if someone steals something you own and profits in any way off it, you're telling me that you will sit and be quiet about it simply because you didn't willingly give them the item? So what you're saying is that youre okay with being robbed. Gotcha.

@valleyshrew 3 года назад

@@patriciamcintyre1667 Should I start charging people to smell my farts too, since these atoms were also once part of my body and are being stolen? If they take biological waste from me that I had no use for, and use it to save lots of peoples' lives and advance science I would be perfectly fine with it, why wouldn't everyone?

@tcf70tyrannosapiensbonsai Год назад

If all scientists were courageous and idealists, as shown in this episode, we wouldn't stick in this socioeconomic catastrophy. Instead of learning how earth is renewing itself through cycles, we were tought the oneway from good to waste philosophy of entropy.

@joshualawrencevlog301 3 года назад

is there really still a person who does not know about the existence of FBC fund and their algorithm?

@TheSavageJCE 3 года назад

What’s the Hostess name ?

@zzz_zzz_ZZZ_zzz_ZZZ_ZZZ_Z_z-ZZ 3 года назад

She makes cool videos too, check her out m.ru-vid.com/video/%D0%B2%D0%B8%D0%B4%D0%B5%D0%BE-d0tGBCCE0lc.html

@IanGrams 3 года назад

That's Rose Bear Don't Walk and she's the newest member of the SciShow team. If you pause during the credits they always list the name of the host for a given episode. This video also listed her in the description but I'm not sure they always do that so the credits is the most reliable source.

@abrahamlucas1549 3 года назад

With gratitude in my heart i want to say thank you for healing me Dr. Osaoji on youtube

@Je.rone_ 3 года назад

I wish i had a great mind in anything😔

@jerrysumner4923 3 года назад

The best of great and good people. Bravo!!!

@Vladimir-et2kq 3 года назад

thought you guys ment 2021 greatest minds not the past

@macaylacayton2915 3 года назад

Me when I hear "Margaret Hamilton:Who was she again? Me when I see a picture:Oh yeah! *laughs* her! I have her as a lego model! my dad got it for me from the museum for flight and space in DC. I even have a book that mentions her I'm pretty sure, it is called "Galaxy Girls". also why would HAMILTON BRING HER 4 YEAR OLD TO WORK?! what did she think she was gonna do? help her program? A 4 YEAR OLD CAN'T UNDERSTAND THE TERMS!

@CritterKeeper01 3 года назад

Sometimes kids get brought to work because their usual daycare wasn't available. Sometimes it's a special chance to see Mommy or Daddy at work (like Take Your Daughter To Work Day) so that kids can see for themselves, and thus understand, that women really do have important jobs, something that wasn't represented in the popular media until recently.

@thingX1x 3 года назад

If we call a container that because it contains something. Why do we not call a box a boxer cause it boxes something in?

@savagepro9060 Год назад

mike tyson enters chat

@minnymouse4753 3 года назад

No one has seen before what about. In mythology. The plesiosaur loom like an ancient sea monster. Ness turned out to be a giant eel though

@kristoffervictorlorico1335 2 года назад

What if there were no discrimation against women and people of color. What achievements could we have had already

@makingkwak329 3 года назад

Guys! Just google: “FBC fund”! You will go nuts!

@RandomPlayIist 3 года назад

160 people must feel inferior after watching this lol.

@Noah-ge4kx 3 года назад

nah it's mostly people that are, for whatever reason (truthfully, the reason is kind of obvious, but), butthurt because no white men were featured in this video.

@thomas.02 3 года назад

@@Noah-ge4kx saw the dislikes, knew what that most likely meant, oh well