Тёмный

How wiggling charges give rise to light | Optics puzzles 2 

3Blue1Brown
Подписаться 6 млн
Просмотров 741 тыс.
50% 1

Опубликовано:

 

18 сен 2024

Поделиться:

Ссылка:

Скачать:

Готовим ссылку...

Добавить в:

Мой плейлист
Посмотреть позже
Комментарии : 1,5 тыс.   
@oreopoj
@oreopoj Год назад
In all honesty, from someone who completed a 4 year undergrad degree in physics and subsequently went on to do a PhD on a topic that involved polarized light - this video does a fantastic job of explaining the phenomenon and clarified many difficult concepts that usually get lost in the mathematical details about light-matter interactions. Bravo I say! I think it’s the animations that this channel author produces which have a magical way of making traditional static textbook diagrams come to life.
@1495978707
@1495978707 Год назад
Indeed, we often only ever see the math, and never get intuition for what’s actually going on when it comes to EM waves
@berryesseen
@berryesseen Год назад
They should add a QR code in textbooks that would link to animations like these to better explain the polarization of light. 2D images do not do the job very well, at least if your 3D imagination skills are not the best. I have an EE undergrad and PhD. EM waves are not my expertise. Until seeing this video, I don’t think that I had understood what they are.
@oreopoj
@oreopoj Год назад
Yeah, that was my feeling too. Did I really understand electrodynamics? The bit about adding a time component to Coulomb’s Law nailed it for me.
@renemunkthalund3581
@renemunkthalund3581 Год назад
So true. Excellent channels like 3blue1brown are instrumental in giving students a more 'tactile' intuition of physics and maths.
@aurelia8028
@aurelia8028 Год назад
I don't think you can truly appreciate what's going on here unless you've completed an intro course in electrodynamics. There's too much going on here for the average person to actually understand.
@tim40gabby25
@tim40gabby25 Год назад
This should be nominated for a communication prize. A winning video. Bravo.
@honkhonk8009
@honkhonk8009 11 месяцев назад
deadass bruh. Explained everything highschool physics refused to elaborate on.
@matthewparker9276
@matthewparker9276 Год назад
Nothing makes me happier than seeing part 2 uploaded less than half an hour after part 1.
@JohnDlugosz
@JohnDlugosz Год назад
But then another twenty minutes later we discover it's _still_ a cliffhanger!
@jacquesfaba55
@jacquesfaba55 Год назад
3B1B trying not to edge his audience challenge (Impossible)
@viliml2763
@viliml2763 Год назад
I couldn't watch the first video immediately so at first glance when the second notification came I honestly thought it was the same video but he changed the title and thumbnail slightly to trick the algorithm into giving him more views.
@AyushKumar47761121
@AyushKumar47761121 Год назад
Being prepared for sucess
@Internet-Antics
@Internet-Antics Год назад
Yaeeeesssss!
@roncho
@roncho Год назад
I have no words to express my admiration for.your work. I have been styudying EM waves for more than 30 years and its th first time I know somebody that can show 3D/EM waves in with this level.of detail in such a clear way. This animations should be what a genius like Maxwell could imagine more than 100 years ago. Its hard to classify you as a simple professor, because all this stuff requiere a high level of artistic sense too...you are like modern matematician artist as Leonardo Davinci was 500 years ago.
@billionai4871
@billionai4871 Год назад
I fully believe 3blue1brown to be in a similar direction of science to what Feynmann did to particle diagrams. Sure, 3b1b and Feynmann didn't actually necessarily come up with new answers to existing problems, but the way they can make everyone looking have an intuition for how current solutions work and maybe have new answers come because of it is just incredible! This is what makes for great teachers, and I hope it gets the recognition it deserves
@andrewshort6440
@andrewshort6440 10 месяцев назад
Super agree, absolutely brilliant thinker, visualizer, teacher. We’re all really lucky to have Grant’s work to learn from and admire.
@understandingtheuniverseth4484
@understandingtheuniverseth4484 Месяц назад
I wonder why don't we have an industry that produces these kind of visualizations that beautifully illustrates science and math topics. May be we might want someone to trigger a revolution just as walt disney made in the animation indsutry.
@iankrasnow5383
@iankrasnow5383 Год назад
In organic chemistry, we learned that you can measure how much the polarized light "rotates" to determine the ratio of left handed to right handed chiral molecules in a racemic mixture. What's surprising, and beautiful, is that this effect is visible on such a length scale. Each full twist is a significant fraction of a meter in length, rather than being microns in length, so it's actually visible and really easy to see!
@hesido
@hesido Год назад
I thought similarly about the length we see here, but in the opposite end; It could well also have needed really large distances.
@Anytus2007
@Anytus2007 Год назад
One thing that was most surprising to me (I guess because I have a Physics PhD but know almost nothing about organic chemistry) is that there would be enough of an imbalance in the chirality of the sugar molecules to see this effect. Naively, I expect nature to not have a strong chiral/parity preference (except for neutrinos) so if you grab a handful of sugar I'd expect roughly 50/50 mix of handedness. But apparently what you actually get with sugar (and lots of other stuff) is a strong preference for one chirality over the other.
@David.C.Velasquez
@David.C.Velasquez Год назад
@@Anytus2007 Invert sugar is easily available... I'm assuming the color spiral would reverse if used here, but obviously just a guess.
@iankrasnow5383
@iankrasnow5383 Год назад
@@Anytus2007 I don't have a chemistry degree, but from my understanding, most of the simple biological molecules, including the simple sugars and amino acids are chiral. All simple sugars are naturally in the D-configuration and all chiral amino acids are in the L-configuration. The inverse configurations do not exist in living things at all. Apparently you can eat L-glucose, it tastes exactly the same as D-glucose, and is nontoxic, but it can't be metabolized. So "reverse polarized sugar" does exist, but it needs to be made synthetically. Most chemical processes that would be done in a lab are not stereoselective, and would produce chiral molecules in a roughly 50/50 mix, but biological processes are very selective.
@noahway13
@noahway13 Год назад
Since sugar and light interact this way, is this the basis for the quantum effect of photosynthesis?
@James2210
@James2210 Год назад
This is what finally made the concept of "light is a wave" click for me. No amount of time in my physics class would have done that. So cool!
@Infinitum-0
@Infinitum-0 Год назад
Frankly, there is not a single channel on this entire platform, that is a of a higher quality. Concise, rigorous, profound; broad and foundational. So most importantly: beautiful! Grant, you are a treasure.
@htomtrites3033
@htomtrites3033 9 месяцев назад
And FUN!
@joshyoung1440
@joshyoung1440 7 месяцев назад
It bugs me when people say things like this who have not seen every "single" channel on youtube. His videos are highly explanatory. That's their job.
@MinecraftLiqid
@MinecraftLiqid Год назад
I am an undergrad math-physics student that will go on to teach others. Having worked in Manim a bit I cannot fathom the amount of time/skill you had to employ in making this short video. Yet you have already surpassed most of my phisics teachers and I can finally see, that it is indeed possible to learn and teach these things without all the pain I had to endure. This is so much different from the explanations I had been given that I wouldn't even believe it was possible with this much elegance and apparent simplicity of this problem. I can only dream and pray that I will achieve this level of expertise in explaining concepts. You are really the best role model I could dream of and since I hope to be using Manim while teaching as well, I can only thank you for your huge effort you already did for us. You helped me see math and physics with the kind of passion and beauty I saw it before the hardships of university came. I hope this motivation will help me with my studies and that I will have the opportunity to pass this feeling onto my students in the future. You really are among the most brilliant minds in modern times, at least in the field of pedagogy. Hats off to you.
@3blue1brown
@3blue1brown Год назад
Wow, thanks for such kind words. I imagine your students are already very appreciative if you're putting this much thought and care into how you can make learniner easier for them.
@MinecraftLiqid
@MinecraftLiqid Год назад
@@3blue1brown Well I don't officially teach anyone yet, but I do hope you will be right. Thanks for the reply, I appreciate it!
@huntersullivan361
@huntersullivan361 Год назад
I'd hope he can make good Manim animations, considering he invented the library. Grant is a god among men.
@adrienpyb1611
@adrienpyb1611 Год назад
​@@3blue1brown have you ever considered partnering with (science) museums and/or VR companies to offer those animations in 3D? I dream of spatially interacting with those kinds of animation (e.g. the radiation law) to get an even more profound intuition (experentially) about what is happening.
@paromita_ghosh
@paromita_ghosh Год назад
Hardships in Uni?
@allanjmcpherson
@allanjmcpherson Год назад
Fun fact: The charge wiggling in the z-direction is called dipole radiation, and it's what antennas use. The drop to zero in the z-direction is why you actually get very poor cell reception when you're directly under a cell tower.
@__Random_user_
@__Random_user_ Год назад
Oh my god, that makes so much sense. Does that mean anything that radiates any kind of signal will do this exact thing?
@allanjmcpherson
@allanjmcpherson Год назад
@@__Random_user_ I wouldnt say anything, because then we wouldnt specify that it's dipole radiation. But certainly a lot of things do
@__Random_user_
@__Random_user_ Год назад
@@allanjmcpherson Yeah I guess so. Also what was the answer to the last question? I don't think he answered it in the video nor comments or I'm blind. The sugar slows down rotation to the right more?
@jackbeda521
@jackbeda521 Год назад
@@__Random_user_ I could be wrong, I have not seen their answer, but I think the answer is that it slows down light rotating "left" i.e. counterclockwise looking down the tube from the light source. We can tell from the diagonals that the polarization of the light is being rotated clockwise, thus the counterclockwise bit must have been slowed down
@__Random_user_
@__Random_user_ Год назад
@@jackbeda521 I may be not understanding the effect but looking at e.g. the thumbnail and picking out let's say the color blue it creates a counter-clockwise spiral. Doesn't that mean the rotation to the right is slowed down?
@Danyel615
@Danyel615 Год назад
For those interested in a textbook that explains all of this and more, the best one I know is "Absorption and Scattering of Light by Small Particles" by Bohren and Huffman. It goes in detail for example in the difference between circular vs linear birefringence and dichroism. Also it was the first source that thought me about the Ewald-Oseen theorem---that's the secret sauce to understand what the index of refraction really is.
@DrDeuteron
@DrDeuteron Год назад
FYI: this effect is used in GPS. The ionosphere rotates the polarization of the L-band signal (Faraday rotation). By transmitting circular polarized radio at 2 frequencies, L1 and L2, the difference in the delay can be used to find the total delay, and since GPS is based on timing, you need to know the travel time btw satellite and receiver.
Год назад
Really nice timing with the video Scott Manley uploaded on how gps works.
@TheToric
@TheToric Год назад
That second channel is only available to the military, though, correct?
@DrDeuteron
@DrDeuteron Год назад
@@TheToric idk, they keep changing it. The GPS signal is sophisticated.
@vigilantcosmicpenguin8721
@vigilantcosmicpenguin8721 Год назад
I feel quite happy that I can understand this comment after watching the video.
@Jodabomb24
@Jodabomb24 Год назад
This is actually a different sort of effect. The presence of a chiral molecule causes something called optical activity, whereas Faraday rotation is caused by a magnetic field along the propagation direction of the light. Both cause circular birefringence, but they are different effects arising from different physics. (And they are distinguishable; optical isolators are built using the Faraday effect because of the way that light behaves when you send it *back* through the tube, whereas an optically active material would do the opposite of what you want in that situation.)
@bimblinghill
@bimblinghill Год назад
Something in my brain went click. Having experienced years of education, dozens of books, hundreds of videos in this general area, this video makes several fundamentals I've never understood just jump out. An outstanding piece of educational work. Thank you!
@bolognious2263
@bolognious2263 Год назад
The visualizations of the fields youve created are honestly astounding. I am a post-masters student with a specialty in Quantum Optics and it was just so nice to see this visualized this way. Sometimes the visual connection really just helps it all make more sense.
@oreopoj
@oreopoj Год назад
Yeah, same for me too. See my comment above. It’s stunning to see this phenomenon animated many years after conceptualizing from textbook diagrams.
@Namerson
@Namerson Год назад
Post-masters student..?
@bolognious2263
@bolognious2263 Год назад
@@Namerson "Post" generally means "after", so this implies I have finished my masters.
@Namerson
@Namerson Год назад
@@bolognious2263 I know what the prefix means, but that isn't how you say it in English. The correct way that native speakers would describe your situation, would be: 'have/ing a masters'. Post-masters student implies you have both completed a master's and are a student.
@David.C.Velasquez
@David.C.Velasquez Год назад
@@Namerson Pedantic american?
@Muetzenmax
@Muetzenmax Год назад
I have been working with light scattering techniques and have gathered an understanding of the underlying phenomena over many years. This is the first time that i see such a high density of high quality and intuitively understandable visualizations on this otherwise difficult to grasp topic. Truly useful for beginners and advanced alike. Great video!
@francogassibe5265
@francogassibe5265 Год назад
You are a math rockstar dude. This videos are the top cream educational content for ppl who don't want to smash their heads against books but still want insight. Thank you.
@benb3928
@benb3928 Год назад
..and just as gifted of an educator. The gratitude I feel to enjoy his math videos, and free no less, is only slightly tempered by the wish to see content of this quality in other subjects. 😅
@markdaniel8740
@markdaniel8740 Год назад
He makes it easy to keep up and understand. This topic could easily be made to put people to sleep.
@ConorCraig
@ConorCraig Год назад
Hard to describe how good this video is other than to say: Nothing has made these concepts more intuitive and easy to understand than this video.
@Biga101011
@Biga101011 Год назад
Wow. This, and the part 1, are just mesmerizing to watch. Very well put together and just beautiful with the combination of the footage from the setup and the animations. Some of the best editing I have seen and the cadence of the presentation matches so well with it and delivers the information at a very natural pace. I especially appreciate the little caveats that you give. They really help to keep people on track.
@benb3928
@benb3928 Год назад
exactly this. posted my comment before reading..
@SilverwingVFX
@SilverwingVFX Год назад
Wow. I am blown away 🤯 This is a master class not only in physics of light but also in creating amazing animations that show the core of what´s happening. As a 3D artist specialized in photorealistic imagery. This series pushed me a whole lot deeper into the rabbit hole. I know about the principles of light. But the detail in which you show it and make it understandable for mere mortals like me is mind-blowing. Handy down one of the videos I resonated the most lately (pun intended) ✨
@khellstr
@khellstr Год назад
Will there be soon tutorial how to shade physically correct rainbow-colored sugar water tube in Octane ? :D That would need some explaining what is the point on that, or at least links to these videos. In reality, it would be quite hard, if not impossible. As far as I know, Octane doesn't have any way to handle polarized light, not to even mention circular polarized light.
@vivekpanchal3338
@vivekpanchal3338 Год назад
Animations are just amazing 😍😍,,, Every professor explaining Maxwell's equations and how it predicts the origin of light, needs this kind of animations to illustrate how certain vector algebra operations is resulting in certain results to visualise what is going on. Really amazing 👏🏻👏🏻👏🏻, In history you will be remembered as one of the youtubers who revolutionaised the process of learning and understanding anything intuitively.
@rajaparameswaran1119
@rajaparameswaran1119 Год назад
Truly a symphony in animation. Every time I watch this video catch another nuance of EM wave propagation. Deserves a Nobel prize for illustration!.
@rishikeshmuppana1155
@rishikeshmuppana1155 Год назад
Wow, an unlisted 3b1b episode! Nice!
@puneetkumarsingh1484
@puneetkumarsingh1484 Год назад
Super Excited for the third part 😁
@babblebam
@babblebam Год назад
As a fresh masters radioelectronics graduate, I wish our professors had animations like this.
@InXLsisDeo
@InXLsisDeo Год назад
Noone had animations like this, undergraduate students are lucky to have 3b1b explain the phenomena qualitatively so well.
@DrDeuteron
@DrDeuteron Год назад
@@InXLsisDeo His visualizations are top notch. Back in the day, you had to come up with them in your head to be a successful student.
@mastershooter64
@mastershooter64 Год назад
Be the change you want to see, now you have the opportunity to make animations like this for your students :)
@nekdonikde5317
@nekdonikde5317 Год назад
@babblebam Ahoj! Tebe bych tu nečekal :D
@herobrine1847
@herobrine1847 Год назад
@@mastershooter64haha… you illustrate a very good point. People can wish for a million dollars if they wanted. They don’t realize just how much work one has to spend in order to make these kinds of videos. There’s a reason animators on RU-vid do RU-vid full-time. Asking for teachers to produce this kind of content, or replicate its quality on a regular basis is literally like asking a baby to swim at the Olympics.
@juanamenabar1807
@juanamenabar1807 Год назад
As an Artist an Math/Science Lover (I`ve watched all af your videos), This touches me deeply, I can only be grateful through a youtube comment, but really and truly, your work has influenced me deeply for years, at some part of the video I clapped out of joy! Yours truly. - Juan (Amenaza) Amenabar
@jimgu2578
@jimgu2578 Год назад
Light is such a basic yet complicated concept. Look forward to your explanations!
@AdreaSnow
@AdreaSnow Год назад
I'm a theoretical chemistry PhD, who uses quantum mechanics to study molecules and how they behave. This is easily the single best explanation I've come across of electromagnetism, light polarisation, scattering, and how molecules interact with light. I can't wait to see you tackle frequency dependent polarisability in the next one!!
@niacdoial
@niacdoial Год назад
oh, theoretical chemistry PhD, nice! I'm in ...maybe the same field maybe an adjacent one, not sure how it counts. If you don't mind, I actually had a question about something that's missing from my understanding of electronic structure theory: do you know how (/in which levels of theory) $E_{\text{rad}}$ (the thing at 5:00) is taken into account in the electron-electron repulsion? The equations I have in mind always use something based on $\frac{1}{r_{ij}}$ for that.
@AdreaSnow
@AdreaSnow Год назад
@@niacdoial The joy of being a theoretical chemist is that I don't have to try to be a physicist :p I probably learned that at some point, but nowadays I'm more focused on solvation through PCM, which is why I was so excited to see this video in particular.
@niacdoial
@niacdoial Год назад
@@AdreaSnow oh gotcha! well, thanks anyway, and good luck on your PCM work!
@HeisenbergFam
@HeisenbergFam Год назад
Blue doing a double upload in 26 mins is a surprise to be sure, but a welcome one
@EldersOfTheInternet
@EldersOfTheInternet Год назад
Dude, I'm in my 40s and did physics and calculus in school. I struggled hard to be interested in class. In university, my calculus teacher ran away from me toward the lunch room because I accosted him to ask what a limit actually was. He said (at a decent hustle) to take next semesters class. So I dropped out. Your videos bring everything into focus. I'm a programmer who started as a kid in the 80s. I've independently stumbled on cellular automata when trying to simulate physics on a grid only to learn that is old news. The world needs you and teachers with your skills. The work you are doing is amazing, and I'm going to learn how to use your visualisation library. I can watch your videos every day.
@duncanbreland3811
@duncanbreland3811 Год назад
Grant! You win! Specifically relating to the portion on the propagation of light and electric fields, this is the single, most succinctly informative video I may have ever seen on any subject. I am in awe of your ability to explain complex mathematical topics, and how you employ your animations to do it. None of these topics are new to me, and yet you managed to increase my understanding of them by an incredible margin. I feel as though you have just pulled a veil off the universe and let me see it clearly for the first time. There should be an award for videos like this.
@raduetsya
@raduetsya Год назад
Those animations are like straight-to-brain teaching, beautiful work, thank you!
@ice_the_kicker
@ice_the_kicker Год назад
Astonishing. Incredible. To learn what is light (and not just the Maxwell equations) and to understand all these concepts in such a short amount of time, are two things I could have never expected from a RU-vid video. Understanding light is something a young kid would want to do and I am glad that you have done it. Your studies, your contacts (friends and colleagues) your RU-vid career, the development of manim, all of those things contributed to shaking the minds of thousands of people (mine as well) to fall in love with the world around them. I happened to listen to the conversation you had with Lex in the podcast, but I couldn't help but underestimate what you said about the behavior of light when it interacts with sugar, but now I am stunned. Thank you for teaching me a lesson about light as well as being more open to what other people find captivating. You are a great mind.
@thelarchmage
@thelarchmage Год назад
As someone who wears polarized sunglasses all the time due to light sensitivity, I have to think about polarization more than people who do not. For instance, I can't view my phone screen in landscape, as the light is polarized from the phone screen, and it gets completely blocked when I rotate my phone to the landscape orientation. I also see rainbow scattering/interference patterns whenever looking at two thin plastic films that are sufficiently close to each other with light passing through them.
@billr3053
@billr3053 Год назад
LCD screens depend on polarized light such as watches for example. They are polarized in a certain direction for a reason: to make them still visible for people who wear polarized glasses. Of course the polarization direction in sunglasses has to be fixed and consistent in a certain direction because the point of them is to eliminate glare from horizontal surfaces like water.
@billr3053
@billr3053 Год назад
Also it’s fun to observe car windshields and side windows to see the stress patterns. I don’t pretend to know all about automotive glass but it’s a very complicated lamination process to strengthen it or to have it shatter in certain size and direction of slivers for safety.
@Sup3rvisoR
@Sup3rvisoR Год назад
Fun fact about phone screens if you use some screen protectors they change the orientation of polarized light, I found this out when I installed a new one on my phone and trying to use gps on the car..
@barefootalien
@barefootalien Год назад
Not all OLED phones have a polarizing filter. I'm actually not quite sure why most do now. I suspect it has something to do with needing to polarize the light it shines for biometrics. It may be worth doing some research to find a phone without one. Looking into it myself, it looks like the reason they still do use polarizing filters is primarily to reduce glare for easier daytime visibility, but I had a Samsung Galaxy S7 that didn't, and it was really nice to use with polarized sunglasses on.
@matijaderetic3565
@matijaderetic3565 Год назад
Also parts of the sky are polarized.
@王勝弘-u1d
@王勝弘-u1d 11 месяцев назад
I really get goose bumps while watching this video… The abstract principles are perfectly explained by those simple animations. Thank you for your effort for making such fantastic videos!
@dykam
@dykam Год назад
This might already be one of the most clarifying video series so far I've watched on electric fields (and fields in general). I feel like I've got such an incredible boost in intuition. Some of the footages of the vector fields might benefit of releasing as stereoscopic 3D? While our brains are quite well trained on it by now, we're still seeing a 3d representation of a field effect, reprojected on a 2D screen. Especially in case of the circular vector motions it became hard to parse how the arrows where exactly moving.
@asthmen
@asthmen Год назад
this is a really good idea, i hope your comment gets seen!
@barefootalien
@barefootalien Год назад
Yeah, he did a fantastic job! It's something I've tried many times to explain to people, and it's very difficult to do in words or still drawings.
@AGoodGuyOnTheInternet
@AGoodGuyOnTheInternet Год назад
This. Is. Incredible! Saying this video is a gem does not even do it justice.
@turun_ambartanen
@turun_ambartanen Год назад
Challenge Question: Looking from the light source, the light is twisted clockwise, as that is the direction required to produce the spiral pattern with the "ribbon view" analogy. We can deduce from that that the light that is rotating counter clockwise is slowed down more by the sugar molecule than the light that is rotating clockwise. Maybe I just skipped it, or it wasn't in the video, but I do not know it that is left handed or right handed now. It changes, depending if you look at the light from the light bulb or from the screen.
@ThePondermatic
@ThePondermatic Год назад
I'm glad someone else posted their thoughts on the challenge question! I got the same result and was hoping to be able to confirm it, lol. Based on the animation at 18:10, I believe that Grant describes light that rotates counter-clockwise as right-handed.
@kolskytraveller1369
@kolskytraveller1369 Год назад
As for the 2nd question, I think the light with the higher frequency encounters more sucrose molecules on average, and assuming that their proportion doesn't change much at this scale, the rotation speed should be proportional to the frequency.
@FinBoyXD
@FinBoyXD Год назад
@@ThePondermatic No, the light is moving to the direction of the thumb, and the way the other fingers curl is the rotation. So right-handed is clockwise when you look to the direction the light is moving.
@shanesimms1043
@shanesimms1043 7 месяцев назад
Here is my attempt at an answer: As seen in 18:42, right-handed light rotates clockwise looking from the light source to the receiver, and vice versa. Looking at the video, my intuition says the light is being twisted clockwise looking from the source to the receiver, so there is more right-handed movement. Therefore, I believe the sugar water molecules are slowing down the left-handed light more; that is, the sugar water has a higher index of refraction for left-handed light than right-handed light. Something that confuses me however is that at 20:04, after using red and yellow to represent right- and left-handed light respectively, he shows the result of slowing down right-handed light giving a result of a yellow wave rotating clockwise looking from the source to the receiver, which to me seems backwards. Should it not be a yellow wave rotating counter-clockwise from the source to the receiver? I.e, moving to the left? I'm not sure if he's accidentally flipped the direction there or if I'm fundamentally misunderstanding something, I'd love to know
@Robisquick
@Robisquick Год назад
This..... THIS!!!! I've be trying so so long to deduce what a more accurate 3-d representation of how light or wave energies propogate through a medium or field. It's so hard to hold all the variables in your head not even as just a snapshot, but a continuous motion. This is helping so so much. I'm obsessed with wave functions now thanks a lot.
@hi6go7
@hi6go7 Год назад
I love how elegantly you are able to explain these concepts that are so hard to visualize without the fantastic animations you produce
@Rikkety51
@Rikkety51 Год назад
This might be my favorite science video on any topic ever. And I 've seen a LOT of science videos.
@ChrisBreederveld
@ChrisBreederveld Год назад
Thanks for not making us wait for the follow-up videos!
@HappyNBoy
@HappyNBoy Год назад
Ooooooh! The fact that part 2 came out just an hour later has made me unreasonably happy! Grant, are you trying to be the best RU-vidr of all time? Because this is how you become the best RU-vidr of all time.
@guyedwards22
@guyedwards22 Год назад
Grant, your videos are the healthiest, choicest tidbits of brain food out there 😩 Every time you upload, it's like eating a full meal after weeks of small scraps here and there. You are a master of the educational craft, and it has been amazing seeing you grow to be the king of RU-vid's mathematical content from your beginnings back when I was an undergrad ❤
@balltoball1
@balltoball1 Год назад
that 3d representation of EM propagation lit my BRAIN on fire! i love it! thank you 3blue1brown.
@HuygensOptics
@HuygensOptics Год назад
This video (and the previous one) are Epic. Not just because of the subject, the way that it's explained and the flow, but mainly because of the mind-blowing animations of the physics. By the way, very glad you stuck to classical physics in your explanation.😊
@waelfadlallah8939
@waelfadlallah8939 Год назад
Man because of you i am still wondering what light is 😓
@br3nto
@br3nto Год назад
Huge praise from another genius who also very effectively demonstrates the properties of light!!
@JohnDoe-sg1qb
@JohnDoe-sg1qb Год назад
Finally someone explained polarization clearly. Good work!
@somezw
@somezw Год назад
What an amazing explanation! Truly a masterpiece incorporating both physics and chemistry concepts. Also my answer: The right handed light is slowing down more in the experiment.
@ryannickles3218
@ryannickles3218 11 месяцев назад
I showed this video to a former professor of mine who studies optics/photonics and he called it "clearly some of the best animations of this type of electromagnetic physics ever".
@mayflowerlash11
@mayflowerlash11 Год назад
Grant, this is simply brilliant. Imagining how the electric field from a charge (a moving charge) acts on another charge is damn near impossible. The mind of a cave man did not evolve to deal with the task. Yet you have shown you are capable. That is mind blowing. Do you intent to make an animation showing how the magnetic field oscillates as light is propagated? Thank you for enlightening we mere mortals with such a brilliant and clear explanation.
@hitarthk
@hitarthk Год назад
I've never seen a better explanation of how exactly the wiggling of charge creates a wave of light. Thanks 3b1b ❤
@benb3928
@benb3928 Год назад
fantastic!‼ Having never seen this kind of demo with light and sugar water, the experiment's visuals are certainly striking; however the pace and clarity of the explanation are only surpassed by the next next next level of animated illustrations which I can only gush about when describing this to anyone. So well done and thank you - despite having an EE education, I've never understood the mechanics behind circular polarization, much less encountered a visualization even remotely as clarifying of the concept.
@hideakipage8151
@hideakipage8151 Год назад
Your animations are works of art.
@anderlia52
@anderlia52 Год назад
I have the feeling to see a Richard Feynman's lecture with the power of the most modern illustration/animation tools. Really impressive for the people who have to learn on this rather complex topic. I would have loved being back to school with all this incredible material (compared to the scarcity of the teaching resources at our disposal before the Internet era: one syllabus drafted by some teacher with no specific skill, one or two handbooks at most at the school library, and not the best ones for sure). Congratulations to the authors!
@DobraEspacial
@DobraEspacial Год назад
I simply can't put into words how impeccably well you explained all of this. I don't have words for it. This video is too good to be real. Thank you, seriously.
@marksmod
@marksmod Год назад
Thank you 3b1b for allowing me to understand the world we live in. It makes me feel more connected to our world and to everyone in it... thanks
@dr_vortep
@dr_vortep Год назад
The moment of understanding why stripes are diagonal, before it is shown... wow, that's just amazing! Love your videos about physics, because explaining such complex topics with animations is just so beautiful!
@3blue1brown
@3blue1brown Год назад
Part 3: ru-vid.com/video/%D0%B2%D0%B8%D0%B4%D0%B5%D0%BE-KTzGBJPuJwM.html A few commenters have asked whether you'd see different angles for the diagonal stripes as you change the distance from the tube, as this explanation would imply. It's a good question! We actually did those measurements, where our expectation was for the diagonal angles to become more vertical as the camera moves away from the tube (i.e. there should be less variation in color as you scan your eyes from the top to the bottom). But, that's not what you see! If anything, the boundaries become more horizontal, in direct contradiction to what you'd predict from this explanation. The tentative plan is to talk more about this in the following video because there's a nuance here that's actually related to indices of refraction. I believe what's going on here is that we need to incorporate the lensing effect of the tube. Even when you're standing far away, and the line of sight to the top of the tube is nearly parallel to the line of sight to the bottom, because of how those lines of sight will bend as they pass through the circular boundary of the glass and water, and they will no longer be nearly parallel as they enter the water itself. So in effect, the explanation offered in this video is qualitatively correct, but to make quantitative predictions you need to add more detail.
@Megaemce
@Megaemce Год назад
So can you use a squared "tube"?
@TheAgamemnon911
@TheAgamemnon911 Год назад
Ah, yes... that makes intuitive sense. Looking forward to Part 3!
@blak4831
@blak4831 Год назад
See I was actually expecting lensing to be the main explanation, and was a bit blindsided (and pleasantly surprised) by the geometric explanation in this video
@renedekker9806
@renedekker9806 Год назад
I would have expected the diagonal stripes to form due to the reflection/refraction on the inside of the glass tube. Light with different polarisation gets reflected more or refracted more, depending on the incidence angle of the light. Only light that gets refracted goes outside the tube. It may be a good experiment to put a polarisation filter next to the side of the tube, to see what effect that has.
@DrDeuteron
@DrDeuteron Год назад
@@Megaemce now that is the mind of an experimentalist....or maybe a theorist. idk.
@mec1789
@mec1789 Год назад
Outstanding work!
@koenschouten7994
@koenschouten7994 Год назад
I am not quite convinced by the argument of why the stripes are diagonal. From the footage, it seems that the camera filming the tube is standing quite far away (at least a couple of magnitudes w.r.t the width of the tube). Therefore, I expect this effect due to different angles to be negligible and not appear so prominently. Also, this would mean the slope of the diagonal depends on the distance from which you view the tube. Is this what is actually observed?
@3blue1brown
@3blue1brown Год назад
Excellent question! The plan is to talk more about this in a later video, but the other relevant factor to incorporate here (I believe) is the lensing effect of the tube. When we took measurements at various distances, we did not see the change in angle between diagonal stripes you would expect from the explanation offered in this video alone. But incorporating lensing, even when you're farther away, meaning the lines of sight are closer to parallel, those lines of sight get bent into the water differently, so they will get splayed out, and no longer be nearly parallel.
@koenschouten7994
@koenschouten7994 Год назад
​@@3blue1brown Thanks for your answer! Lensing effects might indeed explain this quite well. I then imagine that the angle of the diagonal stripes actually slightly depends on the sugar concentration, as the refractive index of the solution is depends on it, and also on the colour.
@BrooksMoses
@BrooksMoses Год назад
@@koenschouten7994 Maybe, but I think it's mostly the lensing happening because of the refraction at the air/glass surface, and how it changes the angle at which you're seeing the sugar-water/glass surface. So the concentration wouldn't affect that -- but immersing the tube in a rectangular aquarium full of water would affect it greatly, and would be an entertaining experiment!
@stevenjones8575
@stevenjones8575 Год назад
This might be my favorite video of yours. It was honestly beautiful. I don't use that term a lot.
@logician1234
@logician1234 Год назад
We all just got linearly polarized in order to get to this video
@mpsido
@mpsido Год назад
so impressed by your explanations and simulation views. thank you I had great time watching
@Darthvanger
@Darthvanger Год назад
Wow :) I didn't know you do physics, this is a whole new level! It's so cool to get this beautiful image, and how it simply follows from wiggling charges! With a visual proof :)
@shadow_rune6178
@shadow_rune6178 Год назад
this is extremely high quality educational content.
@jaroldeenoveson1978
@jaroldeenoveson1978 9 месяцев назад
SO EXCITED FOR PART 3. Two questions: 1) how would this look different in a box shaped container instead of a cylinder? I'd love to see that. 2) how does magnetism play into this? I enjoyed the videos on divergence and curl and maxwells, but I'm having a hard time connecting those ideas to this new equation/intuition about light. Thanks for all you do!
@MooImABunny
@MooImABunny Год назад
Yesss I'm so glad you published part 2 back to back with part 1 and damn, this experiment is beautiful
@AdarshSingh-wv4ff
@AdarshSingh-wv4ff Год назад
Me (philosophising this evening (India) ) : I don't think I understand light properly. Grant: I got ya!
@DataCraftsman
@DataCraftsman Год назад
Man, this is your best video yet. I learned so much.
@cybersans8198
@cybersans8198 Год назад
I believe 3B1B's videos will lift humanity beyond this mortal plane of existence, and into the domain of the gods.
@shiftyparadigm7049
@shiftyparadigm7049 Год назад
Deductive reasoning is reduced to fiction when dispersed with inventive reasoning. In this case, we have charged particles being invented to provide an explanation for an observation. What is a charged particle? Is it made of matter or is matter only an invention to explain an artefact? Steinmetz argues for a universe of dielectric fields and a study of dielectricity and magnetism without the invention of particles. Additionally, I argue that we have charge and discharge and a contemporary scale similar to Celsius which should to be replaced with a scale like kelvin that includes absolute zero and no negative values. Fully charged is dielectricty or counterspace and fully discharged is magnetism or space.
@hashishishin
@hashishishin Год назад
​@@shiftyparadigm7049what is a charge then? Simply some designate to explain the artefact? I argue that there are only arguments and the matter is simple an argumentation plane on which the argumentative energy permeates!
@shiftyparadigm7049
@shiftyparadigm7049 Год назад
@hashishishin not sure I follow completely. I think charge is electromotive force potential or counterspace, the condition required to lead to attraction and when released gives rise to repulsion or space creation. Charge (dielectricity) can be converted to space (magnetism). Fundamentally we have attraction/concentration and repulsion/dilution. They can combine to cancel each other or find themselves in a geometry that gives rise to a vibration between the two (matter, emf etc). The vibration would be categorised into either: electromagnetic or magnetodielectric.
@shambolicentity
@shambolicentity Год назад
Is it an upgrade to leave a plane and arrive in a domain? I guess the affine plane is, in modern parlance, Spec(K[x, y]) for one's chosen field K, and K[x, y] is certainly a domain, so... we are currently living in an affine scheme but will soon inhabit its coordinate ring instead? Yay?
@cybersans8198
@cybersans8198 9 месяцев назад
Every explanation requires axioms or "inventive reasoning". The goal then is to use axioms that feel as intuitive and not needing further explanation as possible. Or in science, the goals to use the most fundamental axioms possible. 3B1B's special ability is to quickly take problems down to super fundamental axioms intuitively. @@shiftyparadigm7049
@nagarjun385
@nagarjun385 Год назад
Bro, I can't believe that we are witnessing this wonderful videos for free. This really blows my mind.
@encoderencoder1031
@encoderencoder1031 Год назад
the fact that linear motion can be described with two circular motion is fantastic.... PI hides every where
@icenarsin5283
@icenarsin5283 Год назад
Amazing animations to make a complex concept understandable. Wow!
@JB-dp8mf
@JB-dp8mf Год назад
Awesome video! I think you neglected an important effect for creating the barber-pole though. I think even at an infinite distance (where perspective is nullified) you'd still see the barber pole, because the light is refracted by the circular edge of the tube. I therefore also expect that the barber-pole would be almost non-existent in a square tube, due to the refracting surface being flat. You'd see a difference between the light coming through each long rectangular face though.
@wolfnederpel
@wolfnederpel Год назад
How does the circle edge result in the barber pole pattern?
@3blue1brown
@3blue1brown Год назад
Indeed, it's an excellent point. The current plan is to talk about this in part 3, since that effect is also so related to the notion of an index of refraction.
@MatthewWalker0
@MatthewWalker0 Год назад
@@wolfnederpel I think it's because the 'perspective' is not really the straight-line angle, but rather the angle between the light's polarization and the tube wall. Boundaries between media can have different transmissivity depending on this angle.
@enricolucarelli816
@enricolucarelli816 Год назад
👏👏👏👏👏👏Watching your videos keeps reminding me to Moore’s law. At first I didn’t realize why. Now I got it: Your first videos where just fantastic, amazing, incredible, and yet you manage to surpass yourself again and again, and you just keep doing it.
@willemvandebeek
@willemvandebeek Год назад
Thank you for sharing this, I learned a lot and something new! 🙂 Little nitpick: please colour the oxygen atoms red, nitrogen atoms blue, chloride atoms green, carbon atoms black/dark grey depending on background, and hydrogen atoms white/light grey/completely transparent also depending on background/preference, because otherwise it is extremely confusing to chemists, who are accustomed to that colour scheme. 😁
@benb3928
@benb3928 Год назад
no pleasing some people 😂
@willemvandebeek
@willemvandebeek Год назад
@@benb3928 sorry, the green carbon atoms can be forgiven, however, the oxygen atoms look like nitrogen atoms and the hydrogen atoms look like oxygen atoms, so to a chemist it looks like an odd C6N6O12H18 molecule instead of a simple C6H12O6 sugar molecule, very disorienting... 🤷 😕
@niacdoial
@niacdoial Год назад
oh, I was looking at too small a screen/resolution to notice that lol. ...I raise you a blue sulfur and yellow nitrogen due to a gross mishap on a printer's part
@name_it
@name_it Год назад
It is unbeliavable how much satisfaction brings me that "wiggle effect". Adding the shared knowledge behind it just makes me feel happy 😊 Thank u.
@user-jekish
@user-jekish Год назад
Хочу выразить огромную благодарность автору и создателям этого канал, благодаря вашим трудам, я совсем по другому взглянул на математику. Я убежден, что для абсолютного большинства людей просто необходима какая-то модель, для впитывания математических знаний. Хотел бы попросить у Вас снять ролики про эллиптические интегралы.
@samdunham3946
@samdunham3946 Год назад
This is the best animation of waves from accelerated charges I’ve ever seen! Thank you so much for your work, it is beautiful and greatly appreciated :)
@TheMso82
@TheMso82 Год назад
As always fantastic job! As a professor in the field of biomedical optics, such an intuitive explanation for light, scattering and polarization. With your permission, I'd love to use your animation in my courses, needless to say 'With due credit' :) Can't wait for Part 3!
@uquantum
@uquantum Год назад
A joy to watch and learn from...thanks so much!
@bindajoba9112
@bindajoba9112 Год назад
Love the hidden meta-experiment! It's nice to see you branch off to more realistic experiments. Splitting up the videos to measure viewer reactions compared to control video is a fantastic idea! I'm looking forward to the results!
@ErikScott128
@ErikScott128 Год назад
These two videos (and I'm sure the 3rd one to come) are easily the best videos you've ever done. And all your other videos were already fantastic.
@CptLando
@CptLando Год назад
Excellent video Grant. I don't know if you realized it, but you basically made a video showing how a uniform linear antenna array focuses RF. Then you effectively showed how a phased array focuses energy at boresight. I would love to see the code you wrote show some really cool antenna concepts. Regardless, excellent stuff. Keep asking weird questions and explaining how you figured it out!
@caspermadlener4191
@caspermadlener4191 Год назад
Definitely one of the better videos on this channel! Not only is the animation used to its full capacity, the topic is also amazing, something out of the textbooks!
@udeepttiwari4069
@udeepttiwari4069 Год назад
Your videos never disappoint! Beautiful video!
@IanRichardCole
@IanRichardCole Год назад
I love that you've branched out into experimentation. It's great. Please do more like this. The combination of theory and practical observation is powerful.
@calinacho7704
@calinacho7704 Год назад
Take a shot every time he says "polarised"
@alienbroccoli8296
@alienbroccoli8296 Год назад
Thank you so much for this visualization Grant. As a physicist, watching the concepts i have learnt being animated really adds on to the beauty and passion for physics. If there is anyone who can make people appreciate even the most abstract nature of modern physics, it is you. I hope you make more videos on the said "abstractness" of say, Quantum mechanics or Field theory.
@lukewanner6823
@lukewanner6823 Год назад
It would be awesome to have access to these animations. Also I would love to play around with an interactive version of these animations to play around and help with the intuition. Always love these videos. Thanks for instilling an unending love for understanding the mystery that is this world!
@duesenklipper
@duesenklipper Год назад
I knew, and somewhat understood, most of what's going on here beforehand. But these explanations and visualizations really give a much more intuitive understanding. Congratulations, and thank you, this is _excellently_ done.
@ParadoxProblems
@ParadoxProblems Год назад
An interesting thing to note is the phenomenon of Cherenkov Radiation. This form of radiation does not require acceleration, just high velocity. The way it works is very similar to a Sonic Boom. When the electron moves faster that whatever the maximum speed of radiation is within a material, it generates a "shockwave" of radiation that propogates away as light.
@golfaddict184
@golfaddict184 Год назад
Wow!!! This channel for me usually serves as a guilty pleasure for "pure math" content...turns out you are a gifted physics explainer as well!!! Bravo
@catcatcatcatcatcatcatcatcatca
I almost feel tricked as you offered a very intuitive model and explanation for electromagnetic field and maxwell equations, as well as light polarisation. Through deception you fooled me into developing some intuition of induction.
@DanaTheLateBloomingFruitLoop
Grant, you are amazing! The curiosity and excitement this video has awoken in me, I haven't felt that in such a long time. Thank you for being you and doing what you do.
@lotofAlexa1221
@lotofAlexa1221 Год назад
Wait wut
@lotofAlexa1221
@lotofAlexa1221 Год назад
Did you accidentally put a link for part 2 for the future?
@santinux
@santinux Год назад
This one may be one of the best animations you've made. The way the waves moves exactly as the function shoud be, it is just fantastic. :)
@lesrobinson261
@lesrobinson261 Год назад
This is a masterpiece. THANK YOU 3Blue1Brown!
@qclod
@qclod Год назад
This is both one of the best physics visualizations and a wonderful explanation of a mysterious and beautiful phenomenon. I really really love this video and I hope you cover more physics topics like this.
@kit_spin
@kit_spin Год назад
this is the most comprehensive explanation of how light works i've ever seen. i've never been satisfied with the idea that there were billions of little "beams" of light bouncing off of everything, it never felt intuitive. i feel like i finally "get" it in a way i never did before.
@SellymeYT
@SellymeYT Год назад
The animations in this video are some of your best work yet, and that's an extraordinarily competitive field.
@Rightsideup23
@Rightsideup23 Год назад
Awesome explanation, as always! You have a knack for both asking interesting questions and answering them in an extremely intuitive fashion. I've wondered about why chiral molecules rotate polarized light ever since I first learned about chirality, but I never ended up looking into the phenomenon. Your videos are truly a gift. I look forward to part 3!
Далее
But why would light "slow down"? | Optics puzzles 3
29:24
КОСПЛЕЙ НА СЭНДИ ИЗ СПАНЧБОБА
00:57
ХИТРАЯ БАБУЛЯ #shorts
00:20
Просмотров 1,2 млн
Семья с двойным дном. Рассказ
2:45:06
What is Spin? A Geometric explanation
20:28
Просмотров 330 тыс.
That Time Our Ancestors Almost Went Extinct
11:37
Просмотров 467 тыс.
How does Bluetooth Work?
21:35
Просмотров 9 млн
Feynman's Lost Lecture (ft. 3Blue1Brown)
21:44
Просмотров 3,4 млн
Some light quantum mechanics (with minutephysics)
22:22
The Insane Math Of Knot Theory
35:21
Просмотров 7 млн
The fine structure of the atom
27:50
Просмотров 61 тыс.
How 3 Phase Power works: why 3 phases?
14:41
Просмотров 1 млн