Тёмный

The Case of Mark Twitchell | HasanAbi reacts to Filmmaker Directing His Own Confession 

Daily Dose of HasanAbi
Подписаться 192 тыс.
Просмотров 329 тыс.
50% 1

HasanAbi reacts to When Filmmakers direct their own Confession by ‪@S0CIALCRIME‬
Original Video: • When Filmmakers direct...
Stay Connected:
► HasanAbi is live daily 11am PST on / hasanabi
► Twitter: / hasanthehun
► RU-vid: / @hasanabi
► Instagram: / hasandpiker
Subscribe for daily HasanAbi react videos: /tinyurl.com/dailydoseofhasanabiSub
Watch more TopVideos! tinyurl.com/dd...
Thank you all for watching!
Edited by: Daily Dose of HasanAbi
If you own the copyright of the content shown in this video and would like it to be removed or the Ad-Revenue made from it please contact:
► / ddohasanabi
► dailydoseofhasanabi@gmail.com
About HasanAbi:
Hasan Piker (born July 25, 1991), also known as HasanAbi, is an American twitch streamer and a left-wing political commentator.
#HasanAbi #HasanPiker #truecrime

Опубликовано:

 

7 сен 2024

Поделиться:

Ссылка:

Скачать:

Готовим ссылку...

Добавить в:

Мой плейлист
Посмотреть позже
Комментарии : 346   
@gratianray2
@gratianray2 2 года назад
the worst serial killer meets his match, the worst interrogators
@jingbot1071
@jingbot1071 2 года назад
Thumb war
@thelonewolfie34
@thelonewolfie34 2 года назад
Canada is just an iron lobby for detectives and criminals
@bigroncoleman11
@bigroncoleman11 Год назад
He’s not a serial killer though....
@deadlykitten3004
@deadlykitten3004 Год назад
@@bigroncoleman11 he’s a self-proclaimed serial killer
@Sophia-vk5bq
@Sophia-vk5bq Год назад
@@bigroncoleman11 The garaedj tells a different story eh?
@Jutilaje
@Jutilaje 2 года назад
The cop started folding because - as everyone knows - it's been scientifically proven that Canadians can only handle 7 seconds of confrontation at a time before apologizing, but he's trying to suppress the "sorey"
@flowersinawasteland
@flowersinawasteland Год назад
they’re pretty good at gen0c1ding natives for longer than 7 seconds….
@Jutilaje
@Jutilaje Год назад
@@flowersinawasteland they just got peer pressured into it by the US.
@CyberK4
@CyberK4 Год назад
If that's your view of Canadians, clearly you've never been to Saskatchewan.
@n1t_
@n1t_ 2 года назад
True Crime is back on the menu. Nice
@limelightcapital7958
@limelightcapital7958 2 года назад
Been waiting for this tbh
@ChardeeMacdennis339
@ChardeeMacdennis339 2 года назад
Was just thinking the same!
@MarshallArtsDesign
@MarshallArtsDesign 2 года назад
I hope he reacts to the Chandler Halderson case!
@NecroMancer84
@NecroMancer84 2 года назад
And I'm here for it!
@skatenec
@skatenec 2 года назад
Yummy
@zachtooill
@zachtooill Год назад
I can’t believe the “Garage Technique” failed for the first time since 1916 (when the first garage was invented).
@dakotaloven1362
@dakotaloven1362 2 года назад
Whenever hasan talks about thumb people I think about the thumb thumbs from spy kids just those dudes that were like 100% thumb for some odd reason
@cctomcat321
@cctomcat321 2 года назад
Someone shared an image of one during one of his thumb comments. Indistinguishable from the real cop's photo.
@dakotaloven1362
@dakotaloven1362 2 года назад
@@cctomcat321 well yea man most cops are literally thumb thumbs from the movie they weren’t cgi they were hired cops bro you didn’t know that?
@ianianianianian
@ianianianianian 2 года назад
Hasan confronting his hypothetical wife Nancy about her thumb uncle really cracked me up. and then the cop said garaedj and that really took it to another level. good shit
@Cussyzera
@Cussyzera 2 года назад
Sorry chatter, your thumb son is going to say garaedj
@jheisz19
@jheisz19 2 года назад
As a Canadian I saw nothing wrong with the cops pronunciation and now I’m reconsidering my entire life.
@ianianianianian
@ianianianianian 2 года назад
@@jheisz19 I mean, at least you can be sure that you’ll always improve the mood of anyone who hears you say garage! it’s hilarious
@bacicinvatteneaca
@bacicinvatteneaca 2 года назад
@@Cussyzera he didn't say that. There was no e. And he didn't pronounce the first a.
@Jordan-kq3qw
@Jordan-kq3qw 2 года назад
This dude wrote his confession, walked into the police station and thought, "You know what, changed my mind, I bet I can get away with this murder"
@camelorcaramel5732
@camelorcaramel5732 2 года назад
“This is called the admitting everything technique” *they let him go* it’s very effective.
@BenjyF563
@BenjyF563 2 года назад
I usually use this genre of content to fall asleep (JCS, Matt Orchard and co) and prefer Hasan’s reactions because all the pauses and stuff stretches the already long runtime out so I can just stick it on and check out thank you for the upload :)
@j.s.7894
@j.s.7894 2 года назад
Are we living the same life wtf
@Goodenough_media
@Goodenough_media 2 года назад
Lmaoo either Hassan’s true crime reactions or attack on titan nothing else puts me to sleep quite like these🤣🤣
@chav2002
@chav2002 2 года назад
@@Goodenough_media aot I feel like I'd be too into the show to fall asleep
@rikititi1848
@rikititi1848 2 года назад
Yess me too!!
@Goodenough_media
@Goodenough_media 2 года назад
@@chav2002 even the first season ??? I’ve seen it like 10 times so it’s easy for me to knock out
@ZERO_O7X
@ZERO_O7X 2 года назад
Narrator: "Anyone who was innocent would instantly become confrontational" is the most bullsh!t statement I've ever heard. Some innocent people become immediately enraged when accused, some shut down in disbelief of their situation. I'm so sick of these "armchair psychological interrogation scholars" channels.
@CChissel
@CChissel 2 года назад
This may just be me reaching, but I took it to mean confrontational as proclaiming their innocence and taking a stand, aggressively or passively. Confronting the interrogator by saying something like “what evidence do you have.” Or “that’s bullshit, I didn’t do a fucking thing.” But yeah idk.
@yee2urhaw246
@yee2urhaw246 2 года назад
i think the point is not refuting direct accusations. if you're innocent and accused of something you didnt do, not everyone will fly off at the mouth, but most people would AT LEAST refute it pretty immediately
@auberry8613
@auberry8613 2 года назад
It completely ignores traumatized/neurodivergent people who may shut down or even become agreeable with the accusations
@cats1970
@cats1970 2 года назад
Meanwhile when I feel threatened I try to follow the conversation and hear out enough info as possible so I can find a way out. “I’m 100% convinced you killed that man.” “Yeah.” “People saw you two come in, only you came out.” “Sure.” “You have the exact same Ikea knives as the one used to stab him.” “I do have those yes.” “Since you just confessed, add your signature here please.” “.... ok so I’m gonna need a lawyer since everything you just said was bullshit.” My plan is to just never get suspected bro I’d be done for
@bobbobsled8843
@bobbobsled8843 Год назад
Lol isn’t confrontational and enraged the same thing buddy
@TheSneakyDuck
@TheSneakyDuck 2 года назад
It's awful to see the authorities ga-radgelighting a suspect.
@BeTheAeroplane
@BeTheAeroplane 2 года назад
In the book he changed "John" to "Jim" and thought he'd get away with it 😂
@argosfe7445
@argosfe7445 2 года назад
Innocent or not, if your answer is not "I want to talk to my lawyer", you are making a big mistake.
@chav2002
@chav2002 2 года назад
Cops aren't interested in charging the correct person if they can coerce a confession out of an innocent person they'll be ecstatic. You're 100% correct the number one rule of dealing the police is to shut the fuck up
@stefaniedanchak2526
@stefaniedanchak2526 2 года назад
Yess
@ararepotato1420
@ararepotato1420 2 года назад
No, the proper answer is: "Get me my lawyer." Wanting means you have a desire for your lawyer. You want them to know that this is a demand. Then shut up.
@jjmitch1411
@jjmitch1411 2 года назад
Yep. The first things should be “why am I here?” “What charges am I being tried against” and “I will not speak without a lawyer”
@trashm.1426
@trashm.1426 Год назад
I know this is an old comment but this is terrible advice. Guilty or innocent you get a lawyer and then you shut the f up.
@carysfaerie
@carysfaerie 2 года назад
Zoned out at the beginning because I was thinking about the sauce the pizza delivery didn’t include..snapped back in the room when hasan said THE SAUCES ARE IN! weird
@Maxisamo1
@Maxisamo1 2 года назад
If you played a drinking game to take a shot every time the cop (and only the cop) says "Geraj", you'd be dead halfway through
@helena4863
@helena4863 2 года назад
omg is hasan doing true crime reactions again? im so excited, theyre what got me into his stuff, i missed these so much!
@notbrody6113
@notbrody6113 2 года назад
“Reaction”
@Justhppy2behere
@Justhppy2behere Год назад
@@notbrody6113 shut up?? no one cares??
@Gotrek-sk8rq
@Gotrek-sk8rq 2 года назад
“Cop Phrenology” 🤣
@ZERO_O7X
@ZERO_O7X 2 года назад
Human Thumbs
@storkksoundmedia7778
@storkksoundmedia7778 2 года назад
My favorite garage is the British one.. “Garriage” *rhymes with marriage
@cats1970
@cats1970 2 года назад
4:19 “tf kinda name is twitchel lmao” completely took me out dude. was just sitting here spacing out and nearly choked
@18booma
@18booma 2 года назад
My girlfriend's dad is a true thumb, but we're lesbians, so no chance of a thumb child.
@leethax100
@leethax100 2 года назад
Make sure it's your eggs when the IVF conversation comes around
@solala1312
@solala1312 Год назад
adopt to stop the thumb lineage and own all pigs once again.
@amarevanhook7453
@amarevanhook7453 5 месяцев назад
Ur lucky
@An0nymous_L0gic
@An0nymous_L0gic 3 месяца назад
I mean you could get a donor with thumb genes
@An0nymous_L0gic
@An0nymous_L0gic 3 месяца назад
​@solala1312 how can you assure you don't adopt someone with thumb heritage?
@Hemogoblin127
@Hemogoblin127 2 года назад
I love hasans crime reactions. I love the long content while doing other stuff
@jazzyg6298
@jazzyg6298 2 года назад
These are my favorite videos to watch while doing dishes
@slowloris2894
@slowloris2894 2 года назад
I love when he isnt speaking about how Crimea is justifiably Russian lol. As long as he isnt speaking about the war or the broader left, I love Hasan. However some of the leftists he's been calling nazis(Adam something) or the trans woman (Jay Exci) is kind of disappointing tbh.
@bacicinvatteneaca
@bacicinvatteneaca 2 года назад
@@slowloris2894 Adam Something is a nazi
@londonyes1380
@londonyes1380 2 года назад
@@jazzyg6298 Good choice. I watched today while I changed my bedsheets 👍
@uyentran1234
@uyentran1234 Год назад
same
@twentylush
@twentylush 2 года назад
"You'd be surprised with what I can live with" ok dude. this was his first murder as a serial killer. he won't even get a netflix series and a weird fandom, he can't be saying stuff like that its big cringe.
@solala1312
@solala1312 Год назад
serial killers talking and their inflated ego neven fail to amaze me.
@bexkroezen5995
@bexkroezen5995 2 года назад
I’m sorry but “backseat driving his own assault” is the best part of the whole video.
@mechisweats4282
@mechisweats4282 Год назад
didnt know skill based matchmaking had made its way to police interrogations.
@Jettmingin
@Jettmingin 2 года назад
Only oldheads would remember but Jim Smith is the only good cop ever
@AtulPYadav
@AtulPYadav 2 года назад
Calm, cool, collected. Broke the Rapist Killer Colonel apart in about half hour. It was one of the only moments where Copaganda actually worked one me.
@zyyps
@zyyps 2 года назад
Jim one of the coldest to ever do it fr
@REDlikeBERRIES
@REDlikeBERRIES 2 года назад
throughout my whole life as a Canadian, the way i pronounce 'garage" (I say it like the detective in the video) is the only word I have been made fun buy others hahaha
@AlexanderWBarrett
@AlexanderWBarrett 2 года назад
to ur face
@solace6700
@solace6700 2 года назад
Narrator: dude disappears hasan: LETS FUCKIN GOOOOOO!!!!!
@slowloris2894
@slowloris2894 2 года назад
It scares me to think about sociopaths like Ed Kemper who totally could of gotten out of this horrible interrogation.
@FrshChees91
@FrshChees91 2 года назад
I wonder if he ever would have been caught had he not turned himself in.
@mursuka80
@mursuka80 2 года назад
@@FrshChees91 He would. He killed his mother, so it was just a matter of time. He knew that, so he turned himself in. It had nothing to do with remorse or other BS he said in those interviews.
@PhilipADitko
@PhilipADitko Год назад
No surprise Hassan thinks this detective is doing a poor job interviewing him, when he doesn't know the first thing about police interrogations. Detective Clark did a phenomenal job in the interview. He's only looking at one clip of it. You actually look at the transcript as well as the full video of the entire interview, even before he started pressing him a little bit, he would engage in certain police techniques like asking him where he went to lunch at and what did he have, and if you couldn't remember that's the hint that he's lying, as well as checking the drive-thru footage of a nearby McDonald's if he says he went there to eat. There are other police techniques that this moron is oblivious to, like having a suspect tell their story backwards. He also looks at his mannerism and behavior. Getting a confession isn't an easy peasy thing and for this ass wipe to armchair quarterback him how to do his job is unbelievably pretentious.
@korubi_eCSTatic
@korubi_eCSTatic Год назад
@@PhilipADitkoacab tho
@PhilipADitko
@PhilipADitko Год назад
@@korubi_eCSTatic ^Anime avatar
@Spencer481
@Spencer481 2 года назад
The police had a T ball of a case and still nearly fumbled it at every step.
@bingusenjoyer197
@bingusenjoyer197 11 месяцев назад
fr, the interrogator didn’t even try to sympathize with him to draw the confession out of him or try to lock him into his original story to catch him in a lie, he just went straight to saying “i know you committed the murder, just admit it you pussy!!!” and mocking him in the car like thats gonna do anything. he’s literally just like that other cop from the JCS video that hasan watched that just said “STEVEN!! I KNOW YOU KILLED THAT PRETTY LIL LADY!! STEVEN COME ON MAN!!” except less hilarious to watch and more infuriating
@Lexythegreat_
@Lexythegreat_ 2 года назад
Bro as SOON as he tells him that he has no doubt in his mind that he's involved, a normal human would be like "gimme a lawyer. I want a lawyer. Lawyer. Lawyer please" lololol especially since he JUST offered him one 🤣 😂 😅
@amosbackstrom5366
@amosbackstrom5366 2 года назад
"I don't understand.. I don't understand how I got caught, I had the cleaning supplies, don't you remember when I told you about the cleaning supplies
@apfelstrudeldk5130
@apfelstrudeldk5130 2 года назад
I love to give my view to one of the the OG hasanabi clip channels appreciate ya
@tbxvividos
@tbxvividos 2 года назад
55:05 how u gonna not say anything when they literally show us his license plate was "DRK JEDI"
@kaedence____
@kaedence____ 2 года назад
Ahhhh takes me back to last spring/summer when we watched this stuff haha missed true crime
@playerhateroftheyear1084
@playerhateroftheyear1084 2 года назад
the tribute to the victim is a sweet end to a video that takes the attention away from the killer. going to subscribe to the channel
@Ldogthe1nonly
@Ldogthe1nonly 2 года назад
I hate that I say garage the way I do - a person from Calgary Alberta
@meghanpoplacean2216
@meghanpoplacean2216 2 года назад
As someone who grew up in Edmonton, who the fuck says garage that way?!?
@tasman655
@tasman655 2 года назад
People from out East who live on the north side
@llamaczech
@llamaczech 2 месяца назад
Tbh, and I don't know why Hasan didn't think of it... That's exactly how I'd imagine Schlatt would say "garage."
@flbreglass
@flbreglass 2 года назад
This is one of the greatest throws of all time
@abbycareyyy7755
@abbycareyyy7755 Год назад
My parents are from Nova Scotia and both say “gradge” instead of garage 😂🤢
@bradennotbrendan
@bradennotbrendan Год назад
Shoutout Edmonton, AB 💪 getting the kind of recognition we deserve 1:47 Those look exactly like the condos I rented in Silverberry, lol
@user-xl8kj4lg2r
@user-xl8kj4lg2r 21 день назад
This technique is called the Drop The Ball technique. Absolutely drop the ball, fumble it, recatch and somehow win.
@eclairia404
@eclairia404 2 года назад
I legit put up my thumb and compared it to his face. I will never look at my thumbs the same way.
@garlicinthebread
@garlicinthebread 2 года назад
4:30 right in this little ᵍᵃʳᵃᵍᵉ
@johndey922
@johndey922 2 года назад
It's crazy to hear that this happened right next to where I used to live...
@brendandrislane4560
@brendandrislane4560 2 года назад
What strikes me about true crime murder is how many of the murderers seem either of low intelligence, or reasonably intelligent people who made a mistake or were undisciplined. It makes me wonder about the 40,000 unidentified bodies every year in the US. It makes me wonder about the killers that are not caught. Serial killers that perhaps do not repeat their method, and select victims seemingly at random, with no common repeatable demographic. So their murders do not appear related, and so the existence of such a serial killer is unclear, allowing them to kill with impunity.
@bingusenjoyer197
@bingusenjoyer197 11 месяцев назад
that level of serial killer precision and expertise is usually near impossible to get away with for a long time. a serial killer like this could probably get away with 3-4 murders before being caught, but for a serial killer to pull off what you’re describing long term they would need to have an extensive knowledge of what detectives look for in murder cases, of how to find and target victims, of cybersecurity to hide their digital footprint, proficiency in all weapons, disposal of bodies, hiding all of their physical tracks, and blending into society and appearing normal all before committing their first murder. murderers will also always be behind on time compared to detectives since they only have so much time to get rid of evidence while the police have a crew with an infinite amount of time to investigate. not to mention the stress and adrenaline serial killers get killing someone which leads to a high likelihood of making mistakes in the murder and cleanup. serial killers often get off on killing and will usually taunt the police after getting away with it for a long time believing that they’re invincible and start getting sloppy with their crimes. theres also a very high chance that over a long period of murders they could be caught red handed by dumb luck alone. a serial killer like this is highly highly unrealistic, i’m basically describing agent 47 from the hitman games.
@mandymentzer6357
@mandymentzer6357 10 месяцев назад
Look up Israel keys
@llamaczech
@llamaczech 2 месяца назад
If you look into the vast majority of serial killer cases, they are kind of dumb as rocks and get away with it for as long as they do because of police incompetence, and often times especially with the big names, straight up negligence in the face of victims coming forward. I see no reason to think those 40,000 unidentified bodies a year are part of a different pattern.
@limelightcapital7958
@limelightcapital7958 2 года назад
TRUE CRIME HAS VIDS ARE BACK LFG BOIS!!!!
@thendolethole2381
@thendolethole2381 2 года назад
That cop has strong Thumb Genes hahahaha.
@annavictrix
@annavictrix Год назад
I know about this loser but I’ve never seen the escaped victim’s interrogation footage and I couldn’t stop laughing at him making fun of this Dexter wannabe using movie logic in his attempted murder
@catcatcatcatcatcatcatcatcatca
@catcatcatcatcatcatcatcatcatca 2 года назад
Maybe the most effective interrogation methods are so effective because there are more innocent and scared people near any given crime than the few actually guilty people?
@noodlz_666
@noodlz_666 2 года назад
I'm so happy he's cover The Dork Jedi, Mark Twitchell.
@hi_im_mello
@hi_im_mello Год назад
"Ope, did I say I bought the car for $40? Ope, sorry, I meant I killed him then stole his car and took $40 from his wallet."
@LyfeIllustration
@LyfeIllustration Год назад
My dad says garaRge. Just gotta put that out there cuz I’ve always wondered how the hell he decided that was correct lol
@StanleyKubricksBeard
@StanleyKubricksBeard 2 года назад
Is that guy wearing a John-5 shirt? Merch from the guitarist of Rob Zombie/Marilyn Manson? 🤔
@abit359
@abit359 2 года назад
4:10 I would like to thank Skonk190 for his wonderful Veggietales fact.
@scoobertmcruppert2915
@scoobertmcruppert2915 2 года назад
🤣
@no_ononono3074
@no_ononono3074 Год назад
This entire video... I couldn't help but keep hearing I MISS GA RAGE over and over and over again in my head.
@megshep
@megshep 2 года назад
Why is it always Canadians?? I swear we aren't all nutjobs! 😂
@Maxisamo1
@Maxisamo1 2 года назад
I wanna see Jordan Peterson be the interrogator in these
@rachelsummers4311
@rachelsummers4311 2 года назад
that would be the funniest shit in the world
@tiniaful
@tiniaful 2 года назад
i do want to say garage is a french word and his giving the french intonation on the a. 10/10 prenounciation
@Sneak222
@Sneak222 Год назад
cant believe I was just click baited for so long
@kandykess
@kandykess 2 года назад
JCS IS BACK JCS IS BACK JCS IS BACK JCS IS BACK
@cctomcat321
@cctomcat321 2 года назад
(inspired)
@ThatGuyGoob
@ThatGuyGoob 2 года назад
At 56:00 the detective straight up turned into Trump…
@blondebonetglamsey
@blondebonetglamsey 5 месяцев назад
my favorite part is him calling it a suspense thriller and then willingly describing setting up a scene of torture porn
@catcatcatcatcatcatcatcatcatca
@catcatcatcatcatcatcatcatcatca 2 года назад
“The first thing detective Clark did was opposing the four other digits assigned to the case”
@Ananasboat
@Ananasboat 2 года назад
My mother, from northern Maine says "gaRWARdge" with the second r and everything. I hate it
@readussalehin3736
@readussalehin3736 7 месяцев назад
My man said, “Let’s go dontcha know”😅
@jerrontaylor4611
@jerrontaylor4611 2 года назад
"looks like interrogations are back on the menu boys!!!"
@ToldFate
@ToldFate 2 года назад
“Why!” That nigga panicking
@galexical
@galexical 2 года назад
brooo the ending...from the car to the reveal of the confession 💀💀💀
@0MVR_0
@0MVR_0 8 месяцев назад
Alltinger is a Norwegian last name meaning more or less 'congressional representative' or senator.
@coderedcleaninginc.9942
@coderedcleaninginc.9942 2 года назад
Why does nobody ever fucking ask for a lawyer in these videos I literally don’t understand 😭
@jare3959
@jare3959 Год назад
I knew I recognized that name. I fell out of my seat when he said Edmonton. That's where I live. But I kinda blocked this case out of my mind.
@TheGlassAddiction
@TheGlassAddiction 2 года назад
Canada crimes time heck yeah. This time my province??? Wow
@bryce4443
@bryce4443 11 месяцев назад
"what kind of cleaning supplies do you have" "yeah well I make fake blood and it gets everywhere, like everywhere all the time"
@tayshondeeznuts1921
@tayshondeeznuts1921 Год назад
40:58 " I think he just means twilight " that comment killed me
@kevintipcorn6787
@kevintipcorn6787 2 года назад
More like Dork Jedi
@Tachtress
@Tachtress Месяц назад
The interrogator sounds a little bit like the fitness gram pacer test at some moments
@azazeeel5043
@azazeeel5043 Год назад
9 month old episode but i am still gonna comment because this is infuriating. After 54:00 the guy says 'on either side' and the subtitles just completely lie about 'the sun' in his words.
@hannahcatherine4
@hannahcatherine4 2 года назад
i can't hear garage properly now
@kiraanastasiaandersen1145
@kiraanastasiaandersen1145 2 года назад
Why do these style videos make u unintentionally root for the criminal...? Like, i am all bumbed out when he says something stupid that blows his story haha
@bigspice4538
@bigspice4538 2 года назад
Yessssss back to the murder shit
@DDA69ERS
@DDA69ERS Год назад
Innocent people lie all the time. Just because someone dosnt want to tell cops anything because they will use anything against you, dosnt make you guilty of murder.
@zoosmell_egbert
@zoosmell_egbert 2 года назад
3:00 as a child of a cop, this is why I don't want kids I don't wanna pass down these fuckin thumb genes bro
@khafaniking1230
@khafaniking1230 2 года назад
I want Hasan to react to more Orchard content, his video on JonBennet Ramsay case is enthralling and unsettling.
@najatalfahham1086
@najatalfahham1086 Год назад
You should have not mentioned garage (Peter griffin) and let the chat go offffff 😆
@emilionieto4639
@emilionieto4639 2 года назад
I wouldnt be against a thumb baby
@Cheezeblade
@Cheezeblade Год назад
cop wasnt tilted. he had spent days appealing to his better judgement maybe his humanity. Maybe getting him to at least in his own mind still needing to see himself as at least not the bad guy. WHen all else fails. the guys a killer, go after his ego. Tell him hes NOT as smart or visionary as he mighhhtt might wanna seem. Cant rule out a cold ruthlessness. but antagonizing him through telling him hes a shitty serial killer and got caught first time might hit a nerve. I dont know if the cop even beleived thats who he was dealing with. might have just wanted to fish for a reaction to have him defend his mind or skills.
@Hotlooksamerica
@Hotlooksamerica 2 года назад
4:18 Detective TATTLER gonna tell on YOU!!!
@billbutton8468
@billbutton8468 2 года назад
HOLY SHIT i thought cop was dog shit like hasan but then at the end it shows he read him like a book with those confession writings lmaoooooo
@1f6ixwas9ine
@1f6ixwas9ine 8 месяцев назад
I remember hearing mrballen cover this story to see the interrogation of it is interesting
@Queerdad
@Queerdad 2 года назад
Okay all I can think during this is that the garage joke just isn’t that funny, I can’t believe this got so many callbacks
@monyfornow
@monyfornow 2 года назад
1:01:50 my man spelt neighbour wrong 😂
@DailyDoseOfHasanAbifanchannel
@DailyDoseOfHasanAbifanchannel 2 года назад
LOL true
@ashleyandchloe
@ashleyandchloe 2 года назад
The garage technique 😹🙌
@sayeedkizuk5822
@sayeedkizuk5822 Год назад
Damn I used to live pretty close to there
@amberalert772
@amberalert772 Год назад
Cop interrogating him sounded like a wanna be actor 😂
@jennydiver100
@jennydiver100 Год назад
None of these assistants will turn out to be real.
@alyssabro9092
@alyssabro9092 2 года назад
I never clicked a video so fast
@Itzskimpy
@Itzskimpy Год назад
He even knew about some tactics and was cautious of that, I have no idea how that awareness didn't tell him to shut up the minute he went in there or leave when he was told he was free to go. Obviously don't side with the murderer at all but it's amazing how these people don't understand that even if you were innocent you should never talk without a lawyer
@abbybozek2928
@abbybozek2928 Год назад
I could be wrong but i think the interrogator is using the Reed (or Rhett idk) technique - he was obviously there and he and the cop know that. The cop is trying to get him to admit to a lower offense - i.e. accident on movie scene - because then he can pinpoint that he was lying the whole time and then can book him in prison. Then they can actually grill him into what happened.
@d33pseacreature
@d33pseacreature 2 года назад
TRUE CRIME BACK YASS
@LarryCalcGOAT
@LarryCalcGOAT Год назад
the cop started sounding like me after I forgot what I was saying and am just hoping they don't notice.
Далее
Аруси Точики ❤️❤️❤️
00:13
Просмотров 388 тыс.
HasanAbi reacts to Amanda Knox Documentary
1:20:12
Просмотров 325 тыс.
Hasan Finally Meets Adam Friedland
41:00
Просмотров 65 тыс.
What Caused The Buffalo Shooting?
32:54
Просмотров 352 тыс.
Killer Millenials: Randy Stair and the EGS
13:06
Просмотров 9 тыс.
Аруси Точики ❤️❤️❤️
00:13
Просмотров 388 тыс.