How Donkey Kong made Melee history

Подписаться 103 тыс.

Просмотров 85 тыс.

50% 1

Well, uh…hey, here we are again.
Thank you INTO THE AM for these Elevated Everyday Graphic Tees! Get yours now and get 10% off site-wide when you click the link below: intotheam.com/...
History was made on the Supernova 2024 stage. A 3rd place from Junebug officially surpassed Bum's 4th place at MLG Long Island 2007, becoming the highest placement a Donkey Kong main has seen in over 17 years.
JOIN this channel or become a PATRON to get access to perks:
✅ / turndownforwalt
✅ www.youtube.co...
Follow @arJunebugSmash !
👍 / @arjunebugsmash
👍 x.com/arJunebug
Big thanks to ‪@lemoncakestudios3031‬ for the Supernova footage!
Where do I get my music? Use my referral links for a free month!
👍 www.epidemicso...
👍 www.musicbed.c...
Check out turndownforALT for clips and more content!
🕶 / @turndownforalt
🎥 Don't forget to subscribe: bit.ly/2bMHjyZ
👕 Buy a t-shirt: turndownforwal...
✨ Merch: turndownforwal...
✨ Patreon: / turndownforwalt
✨ Twitter: / turndownforwalt
✨ Twitch: / turndownforwalt
✨ Discord: / discord
✨ TikTok: / turndownforwaltofficial
✨ Instagram: / turndownforwaltofficial
MUSIC:
🎵 MF DOOM - Rapp Snitch Knishes but with the DKC2 Soundfont
🎵 Chris Doerksen - Crusin' Along
🎵 Pacific - Maui
🎵 D Fast - Jungaaaa (Lethal League Blaze OST)
🎵 Pacific - Thinking
🎵 Pizza Tower - A Secret Under the Debris (The Ancient Cheese Secret)
🎵 nothanks - Lost in Mind
🎨 Cover Art by Porky ► / porky_draws
--
#Junebug #DonkeyKong #DK #Supernova2024 #SSC #turndownforwalt #tdfw #SuperSmashBrosMelee #SuperSmashMelee #SSBM

Опубликовано:

10 сен 2024

Ссылка:

Скачать:

Готовим ссылку...

Добавить в:

Мой плейлист

Посмотреть позже

Комментарии : 282

@turndownforwalt 27 дней назад

Thank you INTO THE AM for these Elevated Everyday Graphic Tees! Get yours now and get 10% off site-wide when you click the link below: intotheam.com/WALT

@RobSomeone 27 дней назад

3:50 How have you not broken 100k yet? I don't even play Melee, I just love these stories you tell.

@billwoods7578 27 дней назад

Please never let Jorge commentate again.

@arJunebugSmash 27 дней назад

bit at the end was v sweet walt

@4sfield527 27 дней назад

I've been watching you since like 2014 at Xanadu's in PM, and it's wild to see you go from PM God, to being a melee commentator mostly, to being a melee champion, and standing on a podium with the best players in the world. Good shit, man!

@DarkAuraLord 27 дней назад

@@4sfield527 same here dude. Now we just need Sethlon to show out with Roy. Watching him play PM Roy was my favorite thing, dude was an absolute menace.

@fendour_ 27 дней назад

Junebug twitch stream possibility?

@kevinmartin9674 27 дней назад

player of the year

@SwordMaster3000 27 дней назад

I so badly want to see a dk major tournament win it is unreal but at least you got 3rd place and there is always the next one

@ellachino4799 27 дней назад

rapp snitches with a dk sound fount goes unbelievably hard

@BrayDONee0 27 дней назад

For real. Need that released asap!

@gravitysoul21 27 дней назад

@@BrayDONee0just search up rapp snitch knishes donkey Kong and it’ll pop up by fxsnowy

@ellachino4799 27 дней назад

@@BrayDONee0 i just put "rapp snitches with a dk sound fount" into youtube and it popped up

@Timberwolfee 27 дней назад

Sure does!

@robertgonzalez7562 27 дней назад

Glad someone else noticed. 🔥

@ALloydRH 27 дней назад

Worth acknowledging Junebug actually took a game off Mang0 with that DK.

@ericwolf9664 27 дней назад

From what I saw on the replays, he easily could have taken it to 5 if he didn't have the self kills.

@KyokujiFGC 27 дней назад

@@ericwolf9664 Yeah, the SDs really shook his confidence, I think. He wasn't moving the same way afterwards. I think he was also feeling some fatigue at that point in the tournament. He was doing a lot of desperation grab out of shield that kept getting jumped punished.

@krusher181 27 дней назад

@@KyokujiFGCyeah he was playing for so long he prob isn’t used to it. Mango is very used to playing deep into super majors with a big crowd. One game was impressive imo. Way mango is playing recently… most players can’t win a game against him let alone a set

@nickrulez809765 27 дней назад

I think there is a reasonable chance he would have won if he hadn't had that SD.

@kupaxykalee4454 27 дней назад

(on fd)

@Darksilver740 27 дней назад

The ending to Cody 3-0 over June was just unreal. Cody, the WINNER, walks off stage after the game yet Junebug, the LOSER(still 3rd place) has the whole crowd on his back as he basks in the glory of the Bronze medal. I have never seen an interaction like this before

@DarkAuraLord 27 дней назад

Melee is sick.

@plutigvid 27 дней назад

Cody was pissed about it too. There's a clip of him looking at the camera looking all mad and saying something right after Junebug gets the medal

@Extracredittttt 27 дней назад

Reminded me a lot of Abate beating S2J and then getting wiped by Mango. I love Junebug!

@HawaiiPart 27 дней назад

@@plutigvidCan you send me a link? Idk where to find it

@friesfromsc 27 дней назад

@@plutigvidhe extremely obviously mouthed that he was going to the restroom, probably to the staff on stage

@WeAreSTILLYOSHIN 27 дней назад

THE KONGQUEST CONTINUES!!! WE MID TIERS WILL KONGQUER THIS GAME BIT BY BIT!

@anitabath8315 27 дней назад

The rise kongmunism

@A_Person_64 16 дней назад

21XX, Low tiers dominate the meta People fear Zelda, Kirby and Bowser

@lilzpotato846 10 дней назад

@@A_Person_64i was i a north jersey tourney last weekend and I was beating this guys fox, he picked zelda and fucking SMOKED me 😂

$@fractal_aura$

@fractal_aura 8 дней назад

Eggdog invitational was so wild. Junebug played out of his mind

@orange567_ 27 дней назад

The year is 20DK. Donkey Kong is now officially the best character in Melee. Every Fox mains have dropped Fox in favor for DK. The DKs have maximized their punish game, and matches are decided by who can get the first grab. Jmook is the only non-DK player left.

@jackwilliams1468 27 дней назад

The year is 20DK Donkey Kong is now officially the best character in Melee. Every Fox mains have dropped Fox in favor for DK The DKs have maximized their punish game, and matches are decided by who can get the first grab Jmook is the only non-DK player left.

@riboiman4005 27 дней назад

.tfel reyalp KD-non ylno eht si koomJ .barg tsrif eht teg nac ohw yb dediced era sehctam dna ,emag hsinup rieht dezimixam evah sKD ehT .KD rof rovaf ni xoF deppord evah sniam xoF yrevE .eeleM ni retcarahc tseb eht yllaiciffo won si gnoK yeknoD .KD02 si raey ehT

@louiederpman7113 27 дней назад

As mang0 himself has said and been repeated many times: "There is still so much melee left to be played". That last little section really reminded me of that

@MNTNPG 27 дней назад

By the way, the “Junebug-Quang inversion effect” isn’t exclusive to this moment and is an observable phenomenon that Cody once talked about on stream before. He said that, whenever he plays Amsa in bracket, he doesn’t practice with other Yoshis because he actually does worse against Amsa every time he’s done so, for some inexplicable reason. Weird stuff for sure

@nahometesfay1112 27 дней назад

Probably because they play so differently

@TheXell 27 дней назад

The Dong expands further.

@towerdefensebrigadebackup 27 дней назад

Ayo

@peterevans2854 27 дней назад

W comment.

@PierreLucSex 26 дней назад

It is the way

@BrainstormerX37 27 дней назад

0:21 That’s me with my fist up in the bottom left corner, I’m now a footnote in the story of the Donkey Kong renaissance.

@AutumnReel4444 27 дней назад

A valuable key part. Let's go.

@cousinpatsey2471 27 дней назад

"LOOK GARY THERE I AM" energy. I mean that with love

@Materialist39 26 дней назад

SpongeBob ass comment (go off though)

@snipermoose2580 27 дней назад

You love watching a player like Junebug succeed. All the effort he put into a lower tier character is paying off. Especially how happy he was to put on a good performance in front of family and friends in his home town. Junebug is the GOAT, and amazing video Walt

@netmonmatt 27 дней назад

It sucks that they were forced to rebrand, but i gotta admit, SuperNova is an absolutely sick name

@freddiesimmons1394 27 дней назад

Why were they forced

@Blustorm1 27 дней назад

@@freddiesimmons1394 Likely rules Nintendo set when they had tournament register with them. Smash factor became S factor recently too.

@herobrineharry7698 27 дней назад

He IS the leader of the bunch. You DO know him well. And he’s FINALLY back, to kick some tail.

@Fattyb00batty 27 дней назад

Joshmans reaction to getting socked is priceless

@DarkAuraLord 27 дней назад

seriously, I rewound that part like 3 times 😂bro was FLABBERGASTED 💀

@nscott64 27 дней назад

To think that I used to watch Junebug play PM like 10 years ago, not knowing he was going to become one of the most beloved Smash players. We're all here for 20DK!

@HeckYep 27 дней назад

As a dumbass kid who mained DK after falling in love with the Ding Dong kill confirm, I'm so happy with the current state of Smash. It's so validating to my stubborn loyalty to the character. That back air is pure dopamine. I plan to finally try out Slippi just to go ham with DK. Edit: The 9-Wind is so baller, June is a legend to DKs everywhere.

@catcatcatcatcatcatcatcatcatca 27 дней назад

As a viewer, DK has skyrocketed my interest in Melee. As someone who hasn’t played the game since early childhood, I really love the breakdowns of the advanced match-ups, tactics and mechanics. This lets me appriciate the complexity of the game even if I have no time nor spare effort to learn any of them myself. The fact a new character can reach drastically higher results so many years after the games release is a testament to the complexity of the game and more importantly the effort, skill and dedication of the players dedicated to it.

@lemoncakestudios3031 27 дней назад

It was great to work with you Walt! Glad to see my footage put to good use. Let's go Junebug, congrats on the bronze! So cool to watch you dominate Melee in person and can't wait to see where you go from here :)

@paulcochran7007 27 дней назад

Being a part of that crowd was incredible. Definitely one for the books

@ItsMeChair1 27 дней назад

First instance of AsumSaus footage for todays video: 0:20

@HasXXXInCrocs 27 дней назад

This was the first ever major tournament I've attended and holy shit this was the most insane sporting event ever. The crowd was more electric than even when I saw the Caps in the play offs the year the won the cup. Even my fiance popped off when June punched Josh for the win! So glad I got to experience that once in a life time event and I'll be going back every single year from now on.

@netglitch_ 27 дней назад

Joshman's reaction at 1:53 to getting raw punched is amazing

@justinclary7760 27 дней назад

Walt, we met briefly after supernova and I mentioned to you that I’ve been playing 10 years with my friends and that they are essentially family at this point in life and moments like this have reinvigorated our passions for this game and community. You’re goddamn right we aren’t stopping anytime soon.

@harlevans8498 27 дней назад

5:37 WOAHHH DK WHAT ARE YOU DOING!!!!

@Aaron-mn2ro 27 дней назад

need a ganon resurgence BADLY

@DarkAuraLord 27 дней назад

Kage, my beloved

@Aaron-mn2ro 27 дней назад

@@DarkAuraLord B I Z Z A R R O F L A M E

@DarkAuraLord 27 дней назад

@@Aaron-mn2ro EEEEEEEEEEEEEEEZZZZZZZZZZZZZZZZZZZZZZZ MONEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEY

@SuburbanWitcher 27 дней назад

I used to play/watch a lot of PM in the 3.02-3.5 era with Junebug and man this is such a throwback to see him again

@WyattHoldW 26 дней назад

I’m not even done with the video yet and have to stop and say you did an awesome job with this man. Good shit and thank you

@Agent_27_ 27 дней назад

Watching his run live was insane

@twanheijkoop6753 27 дней назад

Watching his run from home was already incredibly hype, can't imagine being in the crowd live.

@ME-ec6wi 26 дней назад

That minute where he glazed himself was kinda weird lol, great video tho Junebug is soo good at DK

@TimeEnthusiast 27 дней назад

He was a strong presence in PM too..

@MrGetownedLP 27 дней назад

14:59 FeelsStrongMan June is for the people HOLYY

@OkOk-ht6gr 27 дней назад

Is crazy how I just finished your pikachu video and then not even a minute later there’s a new one

@necromax13 24 дня назад

20DK is real. Thanks Junebug, Quang, Ringler, and Akir.

@Heartache2491 25 дней назад

One thing i love about this world, is that whenever we see a big monky doing anything, whether its big monky swing, big monky grab, big monky punch, big monky does sign language, anything related to big monky, we all share a moment. We be united for just a brief moment, because of big monky, whether its big monkys irl or big monkys in games. . . And thats just beautiful to me honestly. All it takes is just a silly big monky for us to put our differences aside and just enjoy the moment, together, nothing dividing us :) ❤

@raphaelmacasaet1081 27 дней назад

POV: Me proving my friends that low tiers are good.

@raphaelmacasaet1081 27 дней назад

You know you have good fans when there are pulling this crap 10:01, 10:17, and 13:29

@A62119 27 дней назад

This is for the guys that used to play the game so much you’d main everyone for a while and saw potential in dk. I love melee

@faithinseabass 26 дней назад

Sick video as Usual, Walt! Keep pumping these out, it's easy to see how much care goes into making them.

@InkedDoesStuff 27 дней назад

As much as I'm rooting for the Kong Renaissance, I'm a bit worried this success might be a little short than we expect. I have no doubt that DK is good, but his results may begin to plateu as good players begin to learn the matchup

@MarMaxGaming 25 дней назад

it's true... writing, voicing, editing... they take forever!

@Bones_ 27 дней назад

Watching top 8 your commentary was really great! Like I was watching an Olympic sport level of quality. Just the right mix of well measured pace, in depth stats, and clear and concise speaking even when the energy picks up

@maxspecs 26 дней назад

The good ol’ “don’t get hit by Giant Punch” challenge. Clearly not impossible but damn hard.

@vilegoblin 23 дня назад

the mario clip at 4:16 of him walking in engine lip synced to what Walt is saying lives rent free in my head

@chewwa1700 27 дней назад

Honestly DK is super fun to watch so it’s sweet seeing him represented more.

@LAST1GGK 13 дней назад

June bug is legit the reason I even can comprehend PM shout out to bro fr

@lasagnahog7695 27 дней назад

With Junebug not playing his character as long as the top players and being able to see mistakes being made as he wins makes me super excited for him, and melee as a whole, going forward. If all melee was was spacies/marth/shiek I wouldn't even bother watching and Junebug gives me hope that that doesn't come to pass.

@Extracredittttt 27 дней назад

It's crazy that, the longer the game has gone on, the more mid-tiers become viable. 20XX ideology was so wrong and I am very glad it was Yoshi and DK both at their peak!

@Stinkbug_Ab 22 дня назад

Im soooo happy Junebug is sticking with it

@Enochuout 27 дней назад

I wouldn't mind if your next video is a DK video. Just keep encouraging Junebug to compete in everything he has opportunity for, more DK is better for everyone.

@drewholmes7356 27 дней назад

Melee is just flat out science at this point. I don't even play melee, much less play competitive, yet this is so captivating to watch.

@SsbMewtwo 27 дней назад

MF DOOM beat on a Walt video

@hockeyfreak896890 26 дней назад

Beautiful storytelling man. Idk why but that ending sequence started to make me tear up haha. Great job as always.

@anakaleflax 27 дней назад

Wow you work quick, Supernova was crazy and it's awesome to see Junebug & DK get more love :D

@MoeSzyslak-nu3zd 24 дня назад

Just found your channel, dude you are amazing. I’ve been on a binge watching all your videos.

@chewwa1700 27 дней назад

20+ years later and the game is still evolving. Incredible. Now the question is, which “mid tier” is next? G&W is a fair bet.

@DualSaga184 27 дней назад

After having watched your previous DK video and then hearing that Junebug made it into the top 8 of this tournament I decided to watch the top 8 and was quite happy with the hype plays Junebug was able to pull out.

@FloetryFox88 27 дней назад

For over 20 years since 2002, I have BEEN saying that DK was a really good character!! I was a DK solo main in in Melee from 2006 to 2011 and was one of the first few people praising the character as a secret high tier for YEARS! Now that people are finally seeing DK's true potential like I have, it truly brings a smile to my face! 😂💯🙌🏿

@MarMaxGaming 25 дней назад

I saw Dk actually won neutral sometimes against Pika with those swift disjointed back airs

@equinox3861 27 дней назад

Current mood: Jorge on commentary for a Junebug set at Supernova 2024

@KincaidCS2 25 дней назад

23 years later, melee is still fucking sick

@TheAlolanRaichu 27 дней назад

hope everyone attending supernova enjoyed their stay in nova! we got lots of roads, lots of grass, lots of suburbs, and lots of breweries :D

@wingzero7678 27 дней назад

Now we just wait another 10 to 20 years for someone to pick up my boy Ganon from the shelf and start winning like DK is now

@tenebrisdumplin4583 27 дней назад

It's pretty funny that DK can function in melee for the exact same reason he's good in later smash titles, Cargo up throw up air is probably the best throw confirm in the series. The utter domination his punish game can levy against fast fallers combined with his tankiness are a very unusual profile for melee. You can even see Mango have to change his style somewhat and resign to walling DK out defensively.

@FortuneKOF 27 дней назад

This is exactly why Melee will be forever timeless. Smash will release a new game, kill the previous entry over and over. but Melee will forever remain standing strong.

@K_v_B 27 дней назад

Thumbnail goes hard.

@danielk7245 27 дней назад

Being in the crowd for this was truly an experience unlike any other

@nicodemos4829 27 дней назад

melee is just magic at this point

@fatalbert135 27 дней назад

Awww yeah. This is what I was waiting for this week

@heyitsmort7744 27 дней назад

“Anything could happen” is such a legendary line before June’s punch 😂

@fraggnum__9660 27 дней назад

Im so happy. I love melee dk and I’ve had a strong feeling for multiple years that he could win a major. Now i have proof.

@jmendozas197 27 дней назад

Once again, you killed it with another banger of a video! It was crazy watching this live.

@astackzzzz277 27 дней назад

One punch man reference on the thumbnail is epic

@mrmediocre848 27 дней назад

I mean, DK does bring out the inner monkey within all of us. I'm pretty sure Supernova would've gone supernova in reality if Junebug won the whole thing

@iMacxXuserXx485 27 дней назад

There will be more ICs representation in the top 50 soon. Nicki is coming for Top 50 with ICs!

@bfors8498 27 дней назад

Junebug is a must watch player

@StepBaum 27 дней назад

Really well made :) watched a couple vids now and you earned a sub. Great analysis!

@joolian4763 27 дней назад

Junebug is likely one of the best smash players of all time, he has been around a long time and has developed the meta across different games. He's a beast.

@Wrestleroftheyear 27 дней назад

Mans should enter the smash iron man or whatever they call playing all the games

@angelodegiule1753 27 дней назад

Low tier mains keep rising up. It’s beautiful to see

@eu4um 27 дней назад

I fucking love June man. He's so cool.

@jaspervermeer659 27 дней назад

I just love how much Junebug is enjoying it

@raptoria1705 17 дней назад

Still unbelievable how there are as many DK players in top 100 as there are jigglypuff players

@kevinmartin9674 27 дней назад

been waiting alllll week for this video. what an event

@MeatSnax 21 день назад

I know we did see a bit of a Sheik renaissance a couple years ago, but I really think there's a ground swell of low execution > large reward among the more recent top players, and we're gonna see optimized Sheiks taking more tournaments than ever. I also think the crowd plays a BIG factor in these low tier heroes, people really underestimate how much it can shake a player, even at the very tippy top, for everybody to be cheering every time you get comboed or KO'd. Think about any time you were playing with somebody who trash talked a lot or played in front of people who wanted you to lose, you really need practiced, professional composure to not have it affect you greatly. Someone like Leffen or Hbox who's used to being cheered against will have a much easier time than a flashy Fox main or someone who's normally a Top 8 underdog, I mean Axe has probably never been cheered against unless he was playing Amsa or Mang0 or somebody that REALLY gets the crowd going.

@gorg9928 27 дней назад

The 20DK is real.

@jpeghub 27 дней назад

i didn't know you did brawlhalla commentary, that's awesome

@spadorade 23 дня назад

Axe shoulda went yink

@x9x9x9x9x9 23 дня назад

Off topic but if into the am brought back their old space hoodies I would buy them. My all time favorite zipup hoodies came from them.

@Extracredittttt 27 дней назад

This was the most hype i have EVER been watching melee. good to day to be from mdva ❤❤❤

@nfisher5685 27 дней назад

Not gonna lie Josh being salty about getting punched when he ran in front of him while he was winding up is hilarious

@Thierce 24 дня назад

It looks like he missed a dashback which cost him the game, so pretty understandable he was salty

@farewell418 22 дня назад

He was probably nothing but upset at himself because he probably thinks he’s so stupid for running into it, but it was just a funny mixup that worked. I mean hell look at the #1 most viewed video on this channel, i’d be really upset at myself if someone walked up to me slowly, and downsmashed

@Gabriel64468 27 дней назад

Sick run by June, but almost is doing a lot of lifting in that title ^^‘

@discgolfwes 27 дней назад

The Donkaissance

@Clementinee 26 дней назад

it’ll forever be Super Smash Con

@theDRomansway 27 дней назад

WTF you didn't have to make me tear up with that conclusion

@RiskierGoose340 27 дней назад

I think I just realized that the DK-Pika matchup is just Guilty Gear Strive’s Potemkin-Chipp matchup: a slow character who struggles in neutral but can survive a lot of hits and can deal a lot of damage, vs a fast character that is amazing in neutral but doesn’t deal a lot of damage and dies super easily.

@peterevans2854 27 дней назад

Play more stages. The subtlety of stadium contributing to that stock is amazing. Melee OD.