How I Fixed My Smashed in Quarter Panel

Подписаться 133 тыс.

Просмотров 174 тыс.

50% 1

Get videos early: / offbeatgarage
Online Store: www.OffBeatGar...
Instagram: offbeat_garage
Facebook: / obgarage
Snapchat: offbeatgarage
Someone asked for how I repaired the rear quarter panel on my car so here it is. It definitely could be done a lot cleaner I think if you wanted it to be super clean. For me, this was clean for what I needed since majority of the area was getting covered with an overfender.
Learning to Drift Playlist: • Learning to Drift
whatmonstersdo....
Use coupon code "LEDRIFT" to save 15% off the order!
Music by Joakim Karud / joakimkarud
OffBeat Intro and Outro Song by Yoshi Goliat
/ yoshigoliat

Опубликовано:

30 сен 2024

Ссылка:

Скачать:

Готовим ссылку...

Добавить в:

Мой плейлист

Посмотреть позже

Комментарии : 133

@MiekkiVT 6 лет назад

Measure Twice, Cut Once ;)

@ClutchKickJunkies 6 лет назад

Man this was really awesome good work! Just subbed, seen you lone Star drift video

@Appte95 6 лет назад

It would be hilarious if your girlfriends build series has the same intro as you have but with her instead of you.

@mal3762 6 лет назад

HPXReloaded lmao 😂😂😂

@ELDIESTRODIY 6 лет назад

Nice fix way better then remove whole panel

@AlexDegnall 6 лет назад

Didn't come out to bad actually, next time you should overlay the new quarter about half an inch over the old one using a pneumatic panel flanger that way you wont have a gap to bridge but nice vid anyway

@Emils2006 6 лет назад

Did you noticed that gap you had was exactly as wide as 2 angle grinder blades? As you cut off an outer line of both panels, while you had to pick one "overlay" panel, to leave more meat on it.

@key.5244 6 лет назад

He should have cut it too thick/long, then slowly took more and more off as needed. It would have fit a lot cleaner and easier.

@WestCoastChomeur 6 лет назад

Tactactactactactactactactactactactac .............. tactactac ... tactactactactactactac ...

@InitialEngineers 6 лет назад

Who else saw the thumbnail and was like “ this jackass just put an overfender on it “ .

@jumpinjojo 6 лет назад

Initial Engineers No one.

@M3xiiii 6 лет назад

i sure did but the kid surprised me , and im glad he did. . has good knowledge in the automotive field

@BartramJ 4 года назад

joseph migliore I did

@Mattdpayme 4 года назад

i did

@HKSArKz2 6 лет назад

you should make a video of the correct way to put overfenders on and all the metal work behind it

@key.5244 6 лет назад

Well, if its for a drift car you dont actually *need* metal work under it. I mean unless you want to go as crazy as Bub did on Nate Hamilton's FD car. Otherwise, its not actually dificult, and tons of other people have done that already. Just search "how to put on over fenders" in the bar up there, youll get hundreds of results. There is the 'cut the inner fender well and bend it over the outer fender' method, then there's the 'cut out the material and fab up a piece of steel to fit directly in the hole, and weld' method. I prefer the second.

@HKSArKz2 6 лет назад

i did do the first wone you said. and i did put the overs on. on second thought i regreted doing it. didnt feel legit if that makes sense? body overall is kinda shot. guess 20 years in the hands on 20 year olds has showed :/

@Crazystories4real 4 года назад

Guess you didn't spell it right

@Yuaaaur 4 года назад

Watching this after spinning out twice

@jeffhogancamp5379 5 лет назад

why did you bother to pound the dent out? Just cut it off in the end.. lol

@91GT347 3 года назад

Im working on the same rype of situation on a Del Sol. Its a bit worse though, and both sides. Ive been using a hydraulic bottle jack and different lengths of wood for different angles, to push it out. So far so good.

@rayravshanov 5 лет назад

2 minutes watching this I was like where did you get friend like that, that has time and where did you find time to hammer like that whole day

@loriw7867 Год назад

You are so talented!! I thank the Lord everyday for people like you!! You are highly highly skilled!!!

@bbyskylee6186 2 года назад

See I have a Dodge Charger and got rear ended by A COP so this is coming outta pocket not way to even fight this. And it’s on my back tail light and took off the side off my light and have a horrible crushed panel and I can’t afford the fit they saying like 10 grand plus 🤦🏽‍♀️

@EverSpec 4 года назад

I TYPE IN REAR QUARTER PANEL REPAIR AND THE FIRST VIDEO IS MY CAR :| we need to be nicer to these things man

@lyons-gk3fk 2 месяца назад

Just did the same thing to my Camaro. Thanks for the weld settings

@204_mod_shop 6 лет назад

You litteraly just put a wide body kit over what ever the fuck you did to your car , that's not really fixing anything so don't put a before and after shot when it's not even the same sheet metal it's a body kit ...

@skulledmonte84 6 лет назад

I see why ya didn't upload in first place gap is big enough to drive a truck threw what happen to all that talk about cutting the panel and staying on the right side of the line haha oops

@mikescudder4621 4 года назад

Dont you just love it when your mates just watch you work?

@robertoleeva985 4 года назад

Thumbs up..!! But it would be easier to just get a car. Lol. You got skill man.!

@JamesMullarneyIsAFraud 2 года назад

ever heard of a dolly? You made hard work of that. It doenst move when there is nothing to bounce off the other side

@thyartisnick5743 4 года назад

When you want to be so drift that the person you bought the car from obtained the damage by "drifting" 😑

@ranyvann7359 Год назад

Oh my God is all wrong you're going to influence wrong work 👎

@suhailahmed4449 4 года назад

A stupid job u ruined the car it's Gona never be straight n Gona rust from joints

@JlPUR 6 лет назад

love the attention to detail on ur build man keep it up!

@TheVamxie 3 года назад

Someone told me i gotta cut off the thing crumpled on what i call my car.

@arlequinantarius858 6 лет назад

Todo el tiempo que perdió martillando y calentando tirada a la basura para eso corta y pega la pieza de una sola vez

@coolhardware65 6 лет назад

Fiberglass body filler than skim coat of putty primer and done.

@nickgretchenroper2496 6 лет назад

I love your work. Keep at it! It’s a great inspiration for us guys that don’t have a huge budget or the notoriety of RU-vid to show off our skills or the lack there of. It inspires me to buy a welder and do my own work, regardless of mistakes. On a serious note, if you were to swap or when you swap your KA for something else in the durple purple 240, would you be willing to sell it to me?

@inzinity 6 лет назад

wtf is that purple things on ur feet? is it some next lvl korogs?

@atomsk1646 3 года назад

What is the body made of? What type of welder?

@Elexander517 6 лет назад

Was on the fence about buying a welder and learning to use it to fix my hatch. this video just made up my mind.

@diytech4u 4 года назад

that weld is weak he needs to learn how to solder 1st

@Doitlike_JC 6 лет назад

Awesome video! I actually just did my brake line tuck like you. I also have a dent in the same spot, might try this if I have too

@Ryan_1997 5 лет назад

Rear panels are a bitch to fix

@mrcarman07 6 лет назад

Damn I remember watching this on snap a long time ago haha

@horizongarage5597 6 лет назад

Where did you get that overfenders from??

@tacocat8884 4 года назад

Squeeker voice much.. ?

@dannylin5980 5 лет назад

how do you measure if one of ur corners is not the same alignment as the other side? I hit my mustang on the left back side corner, my light didnt get hit at all it was just the corner. How do i measure the left side to the right side to see if they are aligned the same? I went and got it repaired, but i just want to double check :).

@jarednoland274 3 года назад

Just a few inches away you had factory weld points cleaned up with body seal sealer.

@imbackgte 6 лет назад

This is how not to do it .... since you had complete panel you should make a scale on the side of the car and make replacment a bit longer and drill couple of holes and then weld it .... you just overcoock the edge of the quaters with weld just to fill 2-3mm gap (that is a huge gap ) it is all wiggly you can see it by the marker on the bottom if you scale it your gap would have metal and it would be much easyer and better and straiter ( less mud will be used )

@bertone83 2 года назад

Not a good repair

@red666A 5 лет назад

look good and need a rear right quarter panel for my 240sx because i have same problem as your. The previous owner damage it.

@kennedywong9854 6 лет назад

Just cut the bad panel off and weld in new one. No need to waste time hammering out bad panel. That just me.

@peturkristinsson9463 4 года назад

I spun in the snow and my drivers side corner went into the bumper corner of a truck, i need to fix my quarter pane

@JasonMvrtinez 6 лет назад

Pretty good job!. Next time just hit it with a 12 pound hammer and block of would and save yourselfself a bunch of time.! Also if you want a cleaner look around tail light pocket just grind down the round spot welds on the seam where quarter meets taillight and gutter area.drill holes in new part where the spot welds were and its will be way faster!

@mason8725 6 лет назад

Hard to tell but to me the disc on the grinder looked pretty thick,like a grinding disc....using a 1mm cutting disc is the way forward and cuts through the metal easier to.

@z33tanner 5 лет назад

I just barely tapped a tire on my first drift event in my daily driver 350z and it dented in my quarter thanks for this video I should be able to pull mine back out.

@blaznmax8877 6 лет назад

Broskie Iam a metalolagist .. you gta use more heat then flash freeze.. Then negative pressure vacuum +< or> 24% differential elevation barometric meter readings.. maddddddd simple

@thicknick734 6 лет назад

i want a coupe but i cant find any clean ones in the northeast, probably just gonna end up buying a hatch if i cant find a decent coupe by may

@firstchoiceanswer7793 6 лет назад

Bro ! You da man! Do a ka video! Just some tips and tricks 🙏🙏🙏🙏🙏 I just got a s14 with a ka any advice or pointers greatly appreciate!! Keep up the good work and fire content

@my93foxmustang1 6 лет назад

Did anyone notice the sexy slippers over socks...lmfao

@cameronbasford8991 6 лет назад

That’s a good way to waste a flap disk. Use a grinding disk to take most of the weld off, then hit it with the flap disk.

@eddylorenzo5033 2 года назад

Nice work

@arnoldntambwe1672 3 года назад

Good work 👍

@magicallyrics8727 6 лет назад

Nice video looks like lots of hours put in on welding.. should just filled with bando and spot repair🤙🏽🤓🔥

@red666A 5 лет назад

Good work check out my insane 240sx...😃

@terran2kk 5 лет назад

I just got a daily beater and it's got that exact same damage. Im going to try to knock the dent out like you did with the hammer and wood.

@DIYeverything513 5 лет назад

Hey brother what type of welding machine are you using. Great work by the way im impressed.

@sr11rami78 4 года назад

Nice one

@johnwaynebrooks 4 года назад

Good job

@TheVamxie 3 года назад

I laughed

@clemsmeca5156 6 лет назад

GG for work

@riverview6120 2 года назад

Dang no leakOS

@leviridgeway5873 6 лет назад

Hitting it with a hammer would actually work really well if it's just a missile😂

@jeanlenor1858 5 лет назад

My question is, when do you have cut out and replace a quarter panel or just repair it?

@МусабегХидиров 5 лет назад

🍕🍕🍕🍕🍕🍕🍕🍕🍕🍕🍕🍕🍕🍕🍕🍕

@Bionixx016 3 года назад

The sped up section was very satisfying

@RetroByLaw 6 лет назад

lol spent hours hitting it with a hammer then did the correct fix lol

@thaonguyen-sp7xf 5 лет назад

You are great with this job. I wish you live near by so I can hire you for this type of job.

@hawaiiaction.1976 6 лет назад

great video braddah.just did my nissan hardbody like that.

@maryjoolson344 3 года назад

"It's as simple as that." LOL Great job!

@davepelfrey3958 6 лет назад

I thought you did a really nice job. I will stay tuned.

@beng9310 6 лет назад

Your welds suggest that you need to hold the gun at more of an angle.

@dallasderma9980 6 лет назад

Way to double team that rear end with nikita, looks sick

@michaelovers688 5 лет назад

Awesome job just did a camry same way turned out good

@SENJIWEED 6 лет назад

i was always thinking why that corner was primered

@allmotordc5rallmotorfa575 5 лет назад

Damn bro thats some hella metal work, nice job!

@trevinhoskinson599 6 лет назад

Still a Little bit confused why u cut up a perfectly good panel to fix your broken one.

@smore1g 6 лет назад

what are you confused about?

@finngurgens3264 6 лет назад

What diameter MIG wire did you use??

@garthstewart6099 4 года назад

Very useful to see this video, thank you!

@aprilcrotch5028 6 лет назад

Awesome video👌 how long did it take to do that job?

@Bentalf 6 лет назад

What kind of welder do you use?

@JohanGavieres 6 лет назад

Such a great video. Great narrating and editing and the welding looks great 💪🏼

@KDD8 4 года назад

I thought your channel's name is beat off garage 😂😂😂

@Alysavos-rd4tp 6 лет назад

damn that turned out great congrats!

@---vu2cz 4 года назад

beatoff

@---vu2cz 4 года назад

love the car btw

@tyrantichigo 6 лет назад

What welder did you use?

@joewontwice 6 лет назад

This man needs more subs!

@gary.richardson 4 года назад

Thanks for sharing!

@jesussavescars807 6 лет назад

U did a great job

@KiNG-fr5ib 6 лет назад

lol nice job dude

@keithkronzo 6 лет назад

Sick video man

@guillen2579 6 лет назад

Nice work 👊🏿

@pfpvita 6 лет назад

that intro though

@RAKNARE93 6 лет назад

Soy la acosadora

@dexterlallo397 6 лет назад

Hardworkk!!!!!

@albertdemo7 6 лет назад

good work !

@akaanth7605 5 лет назад

Great edit