Тёмный

PragerU and Justice: A Conservative Nightmare | Big Joel 

Big Joel
Подписаться 727 тыс.
Просмотров 1,3 млн
50% 1

In this spicy video, I talk about the PragerU video "Social Justice Isn't Justice" hosted by Allie Stuckey. Maybe it's good let's find out!
Support me on Patreon: / bigjoel
Follow me on Twitter: / biggestjoel
Join the Fan Discord: / discord
Edited by Ben from Canada!
PragerU's video: • Social Justice Isn't J...
TED Talk from the Bail Project: • What if we ended the i...
Articles you can read about systemic racism in the justice system:
www.washington...
www.washington...
www.abajournal...
upriseri.com/2...
mediad.publicbr...
journals.sagep...
5harad.com/pap...
Article on public defenders:
www.nytimes.co...
Article on bail:
www.nytimes.co...
Article on people not wanting religion to play a role in government:
www.courthouse...

Опубликовано:

 

29 сен 2024

Поделиться:

Ссылка:

Скачать:

Готовим ссылку...

Добавить в:

Мой плейлист
Посмотреть позже
Комментарии : 6 тыс.   
@mothcub
@mothcub 4 года назад
Wooooo I know I’m gonna be at the charity stream, 3pm eastern time this Saturday! Who else is gonna be there??? (No big joel did NOT ask me to say this)
@PittsburghSonido
@PittsburghSonido 4 года назад
Sounds like Big Seltzer is behind this...
@BigJoel
@BigJoel 4 года назад
RU-vid!
@Riviwriter
@Riviwriter 4 года назад
I will be there at 12 pm California time! Who's with me?
@jaysaini955
@jaysaini955 4 года назад
@@BigJoel Big Joel Can I ask you what you willing to find faults with PragerU, but not the actions of the Left and Isla*m and all thoes crazies?
@jaysaini955
@jaysaini955 4 года назад
@@BigJoel I'd seriosuly be interested.
@FrankAtanassow
@FrankAtanassow 4 года назад
Now there's a bold claim: "Any statement that does not appear verbatim in the Bible is necessarily false." Does it say *that* in the Bible?
@JackgarPrime
@JackgarPrime 4 года назад
We will have to see what the Bible has to say about microchips, or else computers aren't real.
@mariamatedei
@mariamatedei 4 года назад
Entirety of PragerU found dead
@jaysea5939
@jaysea5939 4 года назад
This just in, 1+1 no longer equals 2
@jeffersonclippership2588
@jeffersonclippership2588 4 года назад
RIP Christianity 0 - 2020
@PaintedHoundie
@PaintedHoundie 4 года назад
This reminds me of when i told my mom as a kid "they say there might be life on planets far away" And she said "thats not what the bible says" like ok ms fucking buzzkill
@danielowens6663
@danielowens6663 4 года назад
When PragerU exclaims that "Justice" in the Bible is never preceded by "social" is that not just an oversimplification. I mean to exclaim an ancient book translated from another language would contain a modern idea in the exact words were use it today is just silly and doesn't really say much about the Bible's position on social justice. Just a thought.
@SherrifOfNottingham
@SherrifOfNottingham 4 года назад
The bible doesn't say "Thou must not be a furry" so the bible approves of furries. Oh, sorry people don't like parallels that break their argument do they.
@DouwedeJong
@DouwedeJong 4 года назад
Fun Fact: Genesis and Exodus is written in 10BC
@benjisaac
@benjisaac 4 года назад
Douwe what are you talking about
@TheAZElele
@TheAZElele 4 года назад
And that’s even while we’re ignoring the fact that we’re talking about subjective translations of a book that wasn’t written in English in the first place.
@christophermiller3031
@christophermiller3031 4 года назад
@@DouwedeJong WRONG! the Bible was written 60-100 years after the 'death of jesus'... so not only a sloppy translation... but his story was written in segments, generations after he lived. but yeah... wait... what was the point? lolol
@nystria_
@nystria_ 4 года назад
"favouring the poor over the rich" is exactly what Jesus did in the bible though, wtf is she reading?
@theheeze
@theheeze 4 года назад
Lol if this is the message they want to preach they need new source material
@1TW1-m5i
@1TW1-m5i 4 года назад
YES My God. How do they miss this. The bible is full of stuff about - to put it simply - how rich and powerful people bring on God's ire by exploiting poor people. Read the book of James. Prager is nonsense.
@lopez.jacinto.6726
@lopez.jacinto.6726 4 года назад
Yeah... Jesus was pretty revolutionary (assuming he existed), don't really see why this people use him in their arguments.
@saranghae1saranghae
@saranghae1saranghae 4 года назад
She read the holy book of corporatism, capitalism & racism.
@brendandepaormoore1726
@brendandepaormoore1726 4 года назад
This isn't Christianity, it's "Judaeo-Christianity" a bizzare amalgam that unites the most reactionary elements of both religions in order to selectively use the Old Testament to justify white supremacy.
@omen8491
@omen8491 3 года назад
"Justice is when you get what you deserve." I know, I graduated from first grade too. The rest of us are doing a bit more advanced reading at this point.
@lemondrizzlecake7766
@lemondrizzlecake7766 3 года назад
You've gotta love how much faith they have in the comprehension skills of their audience ;)
@inimitableminimalist
@inimitableminimalist 3 года назад
"Justice is what you get when you go to the store for beer and ice, and they're all out of beer"
@mynamejeff3545
@mynamejeff3545 2 года назад
"Justice is what you get what you deserve" isn't even taught in first grade. If someone hits you, you shouldn't hit them back as hard as you can. If you think someone steals from you, you shouldn't make it your mission to steal from them also. You should get the teacher and have them solve it with you: most likely it's all just a misunderstanding. Eye for an eye makes the whole world blind. These PragerU types have a less developed sense of justice than a kindergartner
@edwinamendelssohn5129
@edwinamendelssohn5129 2 года назад
All the reading that you so doesn't change the definition of justice.
@edwinamendelssohn5129
@edwinamendelssohn5129 2 года назад
@@lemondrizzlecake7766 I've found most progressives to be sorely lacking in elementary comprehension. They are highly contradictory. Down with the patriarchy!! Yay Islam!
@tabithak.9923
@tabithak.9923 4 года назад
Fun fact: lots of Jewish people consider social justice to be a foundational part of their Jewishness.
@paranoid97_
@paranoid97_ 4 года назад
Smh Dennis should follow this :/
@lotemrose1126
@lotemrose1126 4 года назад
The Judaeo in Judaeo-christian really pisses me off.
@august4114
@august4114 4 года назад
Ben Shapiro has left the chat.
@kiptrevor9531
@kiptrevor9531 4 года назад
YEP it's such a big part of the jewish bible seeing it used here as synonymous with the christian one made me feel extremely icky (and im an athiest lol)
@meaninter03
@meaninter03 4 года назад
But they hate Jeebus!! /S
@WiloPolis03
@WiloPolis03 4 года назад
Leftist Christian here, this is the exact reason you can't present religion as a political ideology. It's self-contradictory.
@patricktsai2303
@patricktsai2303 4 года назад
It's 2020. Haven't we learned enough to separate religion from government? I'm a Christian too, btw ;)
@noway325
@noway325 4 года назад
Thank goodness left leaning Christians are the only ones that should exist , Jesus was into social justice
@WiloPolis03
@WiloPolis03 4 года назад
@@patricktsai2303 Oh absolutely, you nailed it. If you don't separate them then it's not religion.
@WiloPolis03
@WiloPolis03 4 года назад
@@noway325 Eh, I have mixed feelings on those types of claims, I think a lot of politics are left up to agency and choice and not directed through spiritual revelation necessarily. Jesus Christ taught to care more about people than personal possessions, and to love everyone equally without bigotry, but those aren't inherently political values.
@firetarrasque4667
@firetarrasque4667 3 года назад
I'd hard disagree with that. It's less that Christianity itself should be a political ideology, and more that certain political views are emergent from holding Christian values. Like, Christ instructs us to turn the other cheek, but the Criminal Justice system is formed from the premise that we should punish people for the things we dictate are their crimes. Thus, to be a Christian, you can't support the criminal justice system.
@LagrimaArdiente
@LagrimaArdiente 4 года назад
Imagine claiming to stand up for "judeo-christian values" and claim the rich are being oppressed in the same breath.
@randomboy3m98
@randomboy3m98 4 года назад
Imagine not doing that and being accused of it.
@CinnapopisGay
@CinnapopisGay 3 года назад
@@randomboy3m98 lmao she literally said that though wdym
@electricwizard1949
@electricwizard1949 2 года назад
"There is only justice". It isn't justice if I can buy myself out of a crime.
@mammoneymelon
@mammoneymelon Год назад
it isn't justice if people die for crimes they didn't commit.
@capital_L283
@capital_L283 7 месяцев назад
​@@mammoneymelon SAY IT LOUDER FOR THE PEOPLE IN THE BACK!!!!!
@kevinw712
@kevinw712 5 месяцев назад
I'm embarrassed how long it took me to arrive at the question "wait, why does bail even exist?" like either you're a danger to the environment while you're waiting to be tried in a court of law or not. everyone gets it or no one should get it. Also just within the last couple years where I learned the phrase "when a crime is dealt with simply by paying a fine that means 'legal with a fee'"
@thejuiceking2219
@thejuiceking2219 3 месяца назад
@@mammoneymelon i mean...didn't jesus also do that?
@mammoneymelon
@mammoneymelon 3 месяца назад
@@thejuiceking2219 Jesus died for the good of all mankind, something He was specifically sent to earth to do. when random people of color are killed for no reason, they are not martyrs or sacrifices. they are just victims of a corrupt system
@BREADSWORD
@BREADSWORD 4 года назад
hate it when I can't eat my gyro that I uber eats'd because the mentions of gyro in the bible weren't preceded by uber eats
@firefancy9928
@firefancy9928 4 года назад
hey! I saw your video on Treasure Planet ages ago, and I loved it. Nice to see you here!
@jacksonp2397
@jacksonp2397 4 года назад
uber ate
@MuttFitness
@MuttFitness 4 года назад
I don't get this joke but love it anyway
@pressquare2383
@pressquare2383 4 года назад
Uber eats'd 😪
@FrankEnanoza
@FrankEnanoza 3 года назад
Uummmm...The simple answer is that you can eat a gyro because of prudence (or common sense) and natural law. Natural law was discovered before Christianity while prudence and natural law are still used today in Christianity
@SonofSethoitae
@SonofSethoitae 4 года назад
Also, like, the Bible _does_ say things that align with social justice: “Learn to do good; seek justice, correct oppression; bring justice to the fatherless, and please the widow’s cause,” (Isaiah 1:17)
@AnkhAnanku
@AnkhAnanku 4 года назад
sakor88 these are some badass excerpts
@j.c.2240
@j.c.2240 4 года назад
@Krónika It's been discovered multiple times that the original Hebrew text said "man shall not lie with boy". Seems the Catholics lost that page
@BY-bj6ic
@BY-bj6ic 4 года назад
@sakor88 many christians conveniently forget about the parts they don't agree with.
@BY-bj6ic
@BY-bj6ic 4 года назад
I remember many passages in the bible that say to love (and assist if I recall correctly) the widow, the orphan, and the alien.
@SonofSethoitae
@SonofSethoitae 4 года назад
@Krónika Didn't say it was progressive. Merely that even surface level reading of the text shows a concern for some kind of social justice, making her statement wrong.
@allsingersme
@allsingersme 4 года назад
on behalf of all jews, let me just roll my eyes at "judeo-christian values"
@allsingersme
@allsingersme 4 года назад
they really aren't jewish at all, big joel, and I'm honestly a little disappointed you just assume that because this christian org claims to have anything to do with judaism it does
@davidmceldowney6827
@davidmceldowney6827 3 года назад
@Michael The Snacker It's nothing new. It's been around since the early 1900s, but around 1980 it started being used as a bit of a dogwhistle for "anti-multiculturalism"
@svjetlanaravlic7713
@svjetlanaravlic7713 3 года назад
On behalf of christians (non-protestant), we're rolling our eyes too
@hewhomustnotbenamed5912
@hewhomustnotbenamed5912 3 года назад
When I look at what "Christian" values were throughout history. I see a lot of oppressing the Jews. Just something to think about whenever these people say "Judeo-Christian".
@allsingersme
@allsingersme 3 года назад
@@hewhomustnotbenamed5912 exactly. Judeo-christian is a way for christians to once again co-opt Judaism to themselves while sounding intellectual and making themselves feel better. The truth is Judaism is a lot closer to islam that it ever will be to Christianity, and it's very culturally christian (which is not the same as being religiously christian don't @ me) to assume that there is any tangible connection between Judaism and christianity.
@scottdarrington6009
@scottdarrington6009 4 года назад
As a good ole Christian boi, it's incredibly mystifying to me that PragerU willingly forgets that the two of the core tenets of Christian belief are justice and, uh, mercy...
@gwills9337
@gwills9337 4 года назад
these kinds of "mistakes" seem to be the rule, not the exception. You should lower your standards for Christians, it'll save you a lot of heart ache
@aarontorres4840
@aarontorres4840 4 года назад
PragerU: "Social justice isn't Justice. The Lord is a God of Social Justice. Here's the problem, the bible doesn't actually say that." -- God: "He who oppresses the poor shows contempt for their Maker, but whoever is kind to the needy honors God" Proverbs 14:31 "Speak up for those who cannot speak for themselves, for the RIGHTS of ALL who are destitute. Speak up and judge RIGHTEOUSLY, and PLEAD the CAUSE of the poor and needy." Proverbs 31:8-9 "The Lord protects the stranger(foreigner), He supports the Fatherless and the Widow, but He thwarts the way of the wicked." Psalms 146:9 Those are "Social Justice" issues and there are far more examples than I quoted. God is more than a God of Social Justice and commands such from His followers. To PragerU I leave this: "My name is blasphemed among the gentiles because of you." God (Romans 24).
@samouflage99
@samouflage99 4 года назад
Amen to that.
@rogerforsberg3910
@rogerforsberg3910 4 года назад
Proverbs is a storehouse of wisdom, Aaron Torres, but I believe you missed the most compelling verse in Proverbs, i.e., Proverbs 17:5: "Whosoever mocketh the poor blasphemeth his Maker; whosoever gloateth over disaster will not go unpunished."
@Debilitator47
@Debilitator47 4 года назад
God damn. Out-scripture mine the scripture miners. Well done.
@colleenwilliams1689
@colleenwilliams1689 4 года назад
Permission to share this comment along with the video?
@rvantong
@rvantong 3 года назад
But the exact words "social justice" never show up in the Bible, so... There.
@Aconitum_napellus
@Aconitum_napellus 4 года назад
''Not if God is consistent.'' When the hell was God consistent? He's a very inconsistent deity, not like Cthulhu.
@LukeMcGuireoides
@LukeMcGuireoides 3 года назад
Haha. Fckn great thread. Short and hilarious
@joannasthings
@joannasthings 3 года назад
praise be to him
@liz.1328
@liz.1328 3 года назад
Dark Lord Elmo is consistent too.
@GeistInTheMachine
@GeistInTheMachine 3 года назад
@@liz.1328 Elmo is an undercover Dark Lord of the Sith.
@potaterjim
@potaterjim 3 года назад
Old god: "yeah, see all these people fuckin? _Burn it to the ground._ What's that? People aren't listening? Sounds like it's time for a _flood the entire earth._ new god: "Hey buddy, murder is wrong mmkay?"
@BeondTheKDGaming
@BeondTheKDGaming 3 года назад
Whenever I see people say "Don't take the Lord's name in vain." I always think that it's not saying omg, it's stuff like PragerU saying God wants you to do the things that PragerU wants you to do.
@mammoneymelon
@mammoneymelon Год назад
that's exactly how i interpret it. using God's name in vain is using it for your own benefit. saying that YOU, a random person, could possibly know what God wants. saying that your hatred is because of God. seeing yourself as a stand-in for the Lord, implying that you are as Holy as He is
@mediamonger6514
@mediamonger6514 4 года назад
This video us hilarious because the distinction between justice and social justice Prager U makes is the distinction between positive and natural law which is literally a thing you're supposed to consider in law. Like the difference between 'did you do the crime' and 'what are the contexts that lead up to this person doing the crime' are two things that YOU HAVE TO CONSIDER when sentencing people.
@oceanusprocellarum6853
@oceanusprocellarum6853 4 года назад
They hate "leftist" colleges, so it's only natural to deduce that none of them ever bothered to go to law school.
@alexturlais8558
@alexturlais8558 4 года назад
Yeah I really dont think they thought this argument through. I mean less than they usually do. I guess according to PU, if someone's forced at gunpoint to rob a corner shop, they should be punished in exactly the same way as someone who does it just for fun.
@vylbird8014
@vylbird8014 4 года назад
Careful with the term 'natural law' - it has a very different meaning to Christians. At least to those who studied theology formally.
@rhealastname266
@rhealastname266 3 года назад
"The great battle of our time is versus Judeo-Christian values vs. Leftist Values," **sad christian anarchist noises**
@mammoneymelon
@mammoneymelon Год назад
we're the cool ones ✊
@Agos226
@Agos226 4 года назад
It’s really telling when the conservative response to people trying to bring systems anything close to fair is seen as “giving special treatment to minorities”
@trentonmcclintock7836
@trentonmcclintock7836 4 года назад
systems already fair to all races.
@jamesbryant8087
@jamesbryant8087 3 года назад
@@trentonmcclintock7836 no, no they do not.
@SharkyMcSnarkface
@SharkyMcSnarkface 3 года назад
When you are privileged, equality looks like tyranny.
@baldbeardedbassist
@baldbeardedbassist 3 года назад
"In fact, it's surprisingly the opposite!" -any logical person when talking about anything PragerU says
@jmw-be6fl
@jmw-be6fl 3 года назад
"Moses,the greatest lawgiver in history" Hammurabi: Am I a joke to you?
@АлексейПлакхин
Society run by Moses laws still exist (orthodox Jews), society run by Hamurabi laws perish. Probably the laws of Hamurabi was not good enough
@spence98
@spence98 4 года назад
'MOSES NEVER SAID HOW MANY YEARS A PERSON SHOULD GO TO JAIL IF THEY STEAL' lol i just choked on my spaghetti
@oldishandwoke-ish1181
@oldishandwoke-ish1181 4 года назад
hayley spencer He also failed to mention internet crime and what punishment God recommends for it. Sloppy work, Moses.
@matthewmuir8884
@matthewmuir8884 4 года назад
5:38 I find it funny how the image just says, "Deuteronomy 16" while only showing part of a sentence; anyone's who has read the Bible can point out that there isn't a single chapter of the Bible that's only a sentence long, and, surely enough, chapter 16 of Deuteronomy covers a wide range of topics, and the section of it that she's misquoting is a section about the appointment of judges, when the majority of the chapter is about Passover. In that section, Moses is giving a small list of things for the judges to do, and immediately preceding "follow justice and only justice," is: "Do not accept a bribe, for a bribe blinds the eyes of the wise and twists the words of the righteous." Hm... I wonder why PragerU didn't mention that part.
@BartekDeGod100
@BartekDeGod100 4 года назад
Who is this “God” and how does this person qualify as “justice”.
@BenjiNM2
@BenjiNM2 4 года назад
"Blessed be the meek, for they will inherit the earth" What is this social justice >:(
@meganfaith4052
@meganfaith4052 3 года назад
After this video “Justice” doesn’t even sound like a word anymore
@Depressed_Spider
@Depressed_Spider 2 года назад
Nature doesn't even have the slightest clue of what "Justice" actually means. Or "Mercy". These are merely vague concepts invented by humans in an attempt to make life easier for them.
@girlfriendcita
@girlfriendcita 4 года назад
Everytime I hear "pragerU" I read it as "pregersU" like an univercity for pregnant people
@barrydheil
@barrydheil 4 года назад
All I can say in regards to the God of Justice v. God of social justice is that using Les Miserables as an example, Javert believes in the God of Justice only, while Jean Valjean believes in the God of social justice. Take that as you will, but only Javert believed he was despicable for what he had done.
@anelisajustanelisa236
@anelisajustanelisa236 4 года назад
Ohhh snap! I think this might actually be THE STRAW 😂😂🙌
@thatjillgirl
@thatjillgirl 4 года назад
I kept thinking of Javert while watching too!
@weatheranddarkness
@weatheranddarkness 4 года назад
As someone who avoids musicals like the plague and who hasn't read the original yet, can you bring me up to speed?
@anelisajustanelisa236
@anelisajustanelisa236 4 года назад
@@weatheranddarkness with pleasure....go to search bar and search a summary 🙂 boom you are up to speed!!
@vylbird8014
@vylbird8014 4 года назад
@@weatheranddarkness Javert is a big believer in justice, as established by the law. To him, the Law is right, always, and he sees his moral duty as enforcing the law. If the Law says a thief should be arrested and imprisoned, he will do it, for that is Justice. If the thief is a child stealing a single loaf of bread... the law says that thieves are to be imprisoned, and justice must be served. He does not make moral decisions for himself, believing that the judgement of one man is no authority to overturn the law as it is written. In modern terms, he is a strict Lawful Neutral. The Law is Justice, and Justice is the Law. Jean Valjean is a very repentant criminal: A convict who broke parole and went on the run, after being arrested and harshly sentenced for a very minor crime. As a criminal, even on parole, he has no chance at rebuilding his life - no landlord will rent to him, no employer will hire him, there is no legitimate occupation available, no customer would trust him, and the police would be constantly looking for any excuse to throw him back in prison. With society seemingly determined to view him always as irredeemable criminal scum, he flees and tries to build a new life under a false identity. The conflict between them is inevitable: To Javert, Jean is a criminal who has escaped the law: Every step he takes as an escapee is an affront to the concept of justice, and justice can only be served when the criminal is back behind bars where he belongs.
@applesas942
@applesas942 Год назад
The methods that help reduce crime and recidivism are what Prager would consider social justice. The methods are more expensive but are shown to be highly effective. In Germany, they put prisoners through skills classes, teach them necessary life skills to live a good life, and often times those people don't commit crime again. Ofc some people still do, but it's effective. The issue is many Americans don't want to invest their money into prisoners. They don't want to invest in their improvement bc they don't believe it's possible. So, we lock them up and pretend they don't exist. We treat them poorly and barely give them any hygeine products. Women in prison have to suffer with period products that could cause infection, aren't enough to actually help, and don't get enough unless they gain money and pay for them. We make it miserable and then we are surprised when prisoners can't cope being back in the world. We isolate them into this new world and don't put any effort into actually teaching people or tackling their mental health. The justice system is so broken.
@inkblot6626
@inkblot6626 4 года назад
I’m consistently amazed at just how empty and vapid PragerU can get. This reaches a new level of emptiness
@ZanahorioGaymes
@ZanahorioGaymes 4 года назад
uploaded 10 seconds ago? don't mind if i do
@nerdpiggy
@nerdpiggy 4 года назад
4:59 PragerU does NOT have a bias in favor of Judaism.
@PlatinumAltaria
@PlatinumAltaria 4 года назад
It kinda does: its founder is jewish, it makes pro-israel propaganda, and it makes plenty of theological arguments. Not good ones, and not ones that exclusively apply to judaism, but still.
@Meladjusted
@Meladjusted 4 года назад
Christian conservatives favor Judaism because it says in the bible that Jebus won't return unless the Holy Land is in the hands of the Jews. Sounds like contradictory nonsense to me, but that's why fundies are so pro-Israel.
@alexturlais8558
@alexturlais8558 4 года назад
@@PlatinumAltaria yeah hes pro Israel, but it's also kind of contradictory that a jew is arguing against social justice. I guess if someone told him about anti semitism he'd call them out for being s leftist.
@PlatinumAltaria
@PlatinumAltaria 4 года назад
@@alexturlais8558 It's not contradictory at all. The problem is that you're thinking of all jews as essentially victims. Dennis Prager isn't a victim of anything, he's the kind of person who victimises others.
@alexturlais8558
@alexturlais8558 4 года назад
@@PlatinumAltaria I'm not saying all Jews are victims, it's just I wonder if he knows that jews have sometimes needed a bit of social justice.
@Andrew-im7fg
@Andrew-im7fg 4 года назад
I love how when it comes to poor crime, they go to the old testament. But when it comes to corporate crime they reference the New testament "...better that 99 guilty go free rather than 1 innocent go to prison".
@adammaher403
@adammaher403 2 года назад
Why does this lady have a permanent Joker smile?
@andreavasquez4355
@andreavasquez4355 2 года назад
Because everything is about society.
@MegaChickenfish
@MegaChickenfish 4 года назад
So their definition of "justice" is "we get what we deserve." *Where the hell is that in the bible?* You've got a combination of scapegoat punishment, where innocents die for the crimes of the guilty. Followed by afterlives, where literally no one gets what they deserve due to infinitely disproportionate punishments only hinging on the detail of how gullible you are towards believing one specific claim.
@firetarrasque4667
@firetarrasque4667 3 года назад
I'd argue it's a bit more complicated than that, and Hell is very much a metaphor, but, basically, yeah. It's nowhere in the Bible.
@catcatcatcatcatcatcatcatcatca
@catcatcatcatcatcatcatcatcatca 4 года назад
You fail to understand conservative mind, namely their relationship with law. Unless law is not unjust, it is not written by anyone, it is not made, it is not interpret. It exists as the definition of Justice. So unless the person thinks the law is unreasonable, it literally means Justice. And if God is God of Justice, God must agree with the constant that is Law. I used to think like this, as a child. The what is just was just reference to the rules available. Only later I understood that this process is actually backwards: that laws are written approximation of what their writers think is just. So what logically follows is that when conservative hears someone disagree about law, it is not just that the person must have a different idea of Justice - but that person must hold a wrong idea of Justice because the right one is obviously written as the Law. This idea is in the very idea of conservativism. You can not be conservative if you lack something you want to keep. That is the law: and it is not taken as a thing that reflects one idea of Justice, it is the basis of Justice, or at least by most parts - bad parts of law are disgrace, not a mistake in writing of the law but a violation of the law. And simultaneously conservative lawmakers don't write laws: they upheld it. The new law is assumed to have existed before in some form, it is not a new, or a product of moral reasoning. It is a return to old, instead of something new.
@rodawallace
@rodawallace 4 года назад
I need WAAAAAAY more drugs for this to begin making sense.
@averybishop1568
@averybishop1568 3 года назад
"God is a god of justice" My Mormon brain: Mercy? Mercy? Mercy???
@15oClock
@15oClock 2 года назад
"God isn't the god of social justice." Then He isn't the god of justice at all. Christianity traditionally prefers a separation of church and state, so once you remove the role of doing better without criminal sentencing, what do you have?
@danielstonebraker656
@danielstonebraker656 2 года назад
You don't see the words "criminal justice" in the Bible either
@williamw6709
@williamw6709 4 года назад
As a cradle-catholic, I was always taught at church that showing kindness to the imprisoned (lawfully or no) was a beautiful act of mercy. If anything, the bible should be used to advocate for prison reform, because creating a system that protects human dignity and sponsors healing and compassion for both sides is, in my view, an undeniably Christ-like thing to do.
@internetbiscuit
@internetbiscuit 2 года назад
All these “Christians” saying that god’s all about justice when the Bible literally says if god were just he’d send us all to hell.
@juliekring7574
@juliekring7574 2 года назад
I will never understand how pro-lifers can support the death penalty
@GulliverOShaughnessy
@GulliverOShaughnessy 9 месяцев назад
They chose the name because it sounds good, not because it represents their ideals in any way.
@BizzeeB
@BizzeeB 4 года назад
Prager University is a university like the Olive Garden is a garden.
@matthewct8167
@matthewct8167 4 года назад
The difference is that olive garden makes something I like
@mayman4255
@mayman4255 4 года назад
@@matthewct8167 Mmm that bread tho
@tictacterminator
@tictacterminator 4 года назад
yeah but I can still get vegetables at the olive garden I can't get an education at prager U lol
@eman22017
@eman22017 4 года назад
PragerU: when you’re here, you’re part of my traditional gay hating, poor loathing, big government despising family!
@RangerRobin0404
@RangerRobin0404 4 года назад
Or Dr. Pepper is actually practicing medicine
@WlatPziupp
@WlatPziupp 4 года назад
When right wingers talk about justice they always mean punishment. In their minds justice and punishment are synonyms
@matthewroberts6833
@matthewroberts6833 4 года назад
Well, if you don't know who the bad people are then how can you convince yourself that you're one of the good ones? Sound moral judgment? Pfffft.
@RubyRobbins88
@RubyRobbins88 4 года назад
I think justice is supposed to be about restoration not vengeance.
@matthewroberts6833
@matthewroberts6833 4 года назад
@uwau That's working under the assumption that two people who commit the same crime will be judged and punished the same and that is laughably not true in pretty much any society.
@matthewroberts6833
@matthewroberts6833 4 года назад
@uwau I disagree. Humanity's greatest crimes against itself have all been seen as legal by the leadership that carried it out. Slavery was legal, genocide was legal, wealth hoarding is legal, denying human rights to social minorities is legal because the people that legalized it had something to gain from it. What is deemed "justice" is defined by partial authorities.
@educprof2160
@educprof2160 4 года назад
@uwau this is the thing tho, lying or corrupting the system for the sake of becoming more powerfull or for your own personal interests is also part of the human behaviour, so your logic in flawd in every way posible.
@jacobodell5231
@jacobodell5231 3 года назад
"The Bible never used the phrase 'social justice.'" Funny, it never mentions smart phones either.
@brittneybrisbin744
@brittneybrisbin744 3 года назад
Or Taco Bell. Curious🤔.
@woodswitch23
@woodswitch23 3 года назад
Or a round earth,or the earth orbiting the sun,or germ theory,or man flying,or man standing on the moon,or evolution.
@leomarvindiaz6733
@leomarvindiaz6733 3 года назад
Gun rights and abortion too
@vylbird8014
@vylbird8014 3 года назад
@@leomarvindiaz6733 Not quite true: It does mention abortion once. It gives instructions for a ritual to carry out an abortion if a woman is accused of infidelity.
@bettyunicorn6132
@bettyunicorn6132 3 года назад
@@vylbird8014 the Bible is pro abortion! 🤭
@nitrocharge2404
@nitrocharge2404 4 года назад
PragerU legitimately angers me. It manages to insult religion, politics, and social issues all in one channel. I think everyone of all walks of life can stand against the sheer lunacy that is PragerU, regardless of their social, religious, and political views
@nitrocharge2404
@nitrocharge2404 4 года назад
@@mstech-gamingandmore1827 There's definitely sources that are mostly unbiased out there, but they're harder to find due to major news outlets advertising and buying up the front page of google
@Yipper64
@Yipper64 4 года назад
You would almost think they are actually a left wing organization that is just trying to make the right look bad by being nuts.
@CallieYote
@CallieYote 4 года назад
@@Yipper64 psyops, psyops all the way down
@Fedro_
@Fedro_ 4 года назад
@@mstech-gamingandmore1827 that was one of the most alienated shit i've ever read jeez
@pietzsche
@pietzsche 4 года назад
just FYI this "I think everyone of all walks of life can get behind the sheer lunacy that is PragerU, regardless of their social, religious, and political views" means people can support them
@midwesterner15
@midwesterner15 4 года назад
Don’t tell conservatives that Jesus forgave a criminal while he was on the cross.
@CarlsCozyCorner
@CarlsCozyCorner 4 года назад
Shhhhhhhh
@rusty7984
@rusty7984 4 года назад
Or that he was killed by law enforcement or he was a man of color
@authenticbaguette6673
@authenticbaguette6673 4 года назад
@@rusty7984 famous jewish anarchist sjw .. Jesus christ
@FilipCordas
@FilipCordas 4 года назад
Wow you must be a genius I don't think any conservative noticed that when reading the Bible, and you are the first person to know this in history. I mean it's not like two criminals and the only one pardoned was the guy that accepted Jesus as God and saying 'And we indeed are suffering justly, for we are receiving what we deserve for our deeds; but this man has done nothing wrong.', And it's not like the whole paragraph is about why would a person claiming to be God accept an unjust punishment. No I think you should inform people about your discovery.
@authenticbaguette6673
@authenticbaguette6673 4 года назад
@@FilipCordas deriving law from the bible is horseshit , though .. No one honestly cares what the bible has to say
@justdirt
@justdirt 4 года назад
"Think of a black thief" Me telling myself to stop imagining a ninja
@Corneilus1
@Corneilus1 3 года назад
Well done, lol
@cryyuni
@cryyuni 3 года назад
Same 💀😂😂
@kaydenchan7093
@kaydenchan7093 3 года назад
So true looool
@afraidofsocks
@afraidofsocks 3 года назад
Lol😂
@trickytreyperfected1482
@trickytreyperfected1482 3 года назад
Fun fact: Ninjas would never dress how they're portrayed in pop culture. It would do the complete opposite of what they want; they'd stand out heavily. They'd dress in normal everyday clothes to blend in.
@frankbenham1745
@frankbenham1745 2 года назад
From a religious standpoint, I've always found the phrase "That's what God wants" to be annoying, full of hubris, and just flat out wrong. So you, a lonely mortal, know what God wants? If a disaster happens it's because "God works in mysterious ways" and "we can't understand the plan that God has for us". However, if it comes to some sort of cultural issue, then people know exactly what God wants and what was intended. I'm a bit rusty, but didn't Moses flee from Egypt with a whole bunch of people (slaves?). I imagine that was against the laws of Egypt at the time.
@thatphatbaby
@thatphatbaby Год назад
It would have been, if there were ever actually any Jewish slaves in Egypt. The Exodus story has zero historical evidence.
@page8301
@page8301 Год назад
@@thatphatbaby Same for global flood or Genesis.
@pishposh3306
@pishposh3306 Год назад
@@thatphatbaby To be fair, the Religion as a whole likely only was ever founded *after* the Exodus, so "Jews" as a distinct group probably didn't exist to be identified by anyone at the time. Israelites, or really any person who lives in the lands we would call Israel today, could have easily been slaves to Egypt at the time. It's a trend in ancient civilizations and given the geography, it's not out of the ordinary. Now, not ALL Israelites would be slaves, but the point is there definitely could have been any number of "Israelite Slaves" in Ancient Egypt at one point, it's not impossible.
@angryfruit4994
@angryfruit4994 4 года назад
When the Bible doesn’t say something so you can’t do it
@Alex-cw3rz
@Alex-cw3rz 4 года назад
No internet for Christian's
@tabithak.9923
@tabithak.9923 4 года назад
Explains why being anti-vax is considered religious by some
@krombopulos_michael
@krombopulos_michael 4 года назад
The Bible never said a single thing about Praeger U, which means its bad.
@mayuthekitsune3306
@mayuthekitsune3306 4 года назад
Damn the bibble doesn't say if I should keep bringing up the bibble joke from Aqua Teen Hunger force so I guess I should stop
@lucca6153
@lucca6153 4 года назад
Air buds law
@jorgeluz9560
@jorgeluz9560 3 года назад
"the bible never says 'social justice'" I'm pretty sure the Bible never says "gay", "capitalism", "communism" or "late-term abortion" either and yet the Christian Right seems to have a lot of opinions on these things based on the Bible.
@cartaphilus242
@cartaphilus242 2 года назад
Christians are literally supposed to advocate for social justice lmaow it's church doctrine
@TheMoistestNugget
@TheMoistestNugget 2 года назад
the term social justice can be heard at just about every catholic theology class or RCIA class and the catholic interpretation of it largely overlaps with the progressive interpretation of it so Prager are just completely wrong (shocking i know)
@zSteve1231
@zSteve1231 2 года назад
This is the worst argument I have ever seen it so bad but so funny. It is like saying school never taught you how to get a job so you can't get one. Also abortion is murder on unborn child and the Bible say "You shall not murder" I can only think of one instance were abortion can be okay and that to save the mother's life but I want to hear you opinion why do you think abortion is okay.
@TheMoistestNugget
@TheMoistestNugget 2 года назад
@@zSteve1231 my brother in christ wtf are you on about
@zSteve1231
@zSteve1231 2 года назад
@@TheMoistestNugget what do you mean?
@goosgasgas4862
@goosgasgas4862 4 года назад
"Social justice asks about a person's economic condition" Yeah...as it should? Surely this woman doesn't believe that a poor man stealing to feed his family and a wealthy man stealing in order to get richer are the same thing? They must know that mitigating circumstances are a thing, right?
@krombopulos_michael
@krombopulos_michael 4 года назад
Even the real justice system does generally understand that and sentences are made by judges on this basis.
@pheonixrises11
@pheonixrises11 4 года назад
not only that, but addressing the causes for the poor man’s crimes could lead to solutions that prevent crimes like it in the future
@Akumasama
@Akumasama 4 года назад
It's PragerU, so the answer is probably just "they don't care". If you are rich, it's because you worked hard and had success. If you are poor, it therefore must be because you haven't worked hard enough, so any social issue you might be having is in your own hands. It's a stupid, short-sighted way to see the world, but it's one I've seen a lot.
@goosgasgas4862
@goosgasgas4862 4 года назад
@@pheonixrises11 Exactly. Arrest a man for trying to feed his son and all you will get is his son stealing to feed himself, or starving to death.
@primrosett
@primrosett 4 года назад
Empathy is too inconvenient.
@mst3kharris
@mst3kharris 3 года назад
I like how she says “historically oppressed” like she thinks it’s funny.
@Lucas-rz3vl
@Lucas-rz3vl 2 года назад
They like to emphasize 'historically' as if to imply it's no longer the case. Beautifully deflecting the inequalities of the system onto a distant and undefined 'past' we've supposedly grown out of, whilst fighting tooth and nail to preserve the system causing the inequalities.
@kristinabeck4260
@kristinabeck4260 3 года назад
My sister just graduated Harvard and gave up a ridiculous salary to work as a public defender. Recently, she was practically crying because she had 1 DAY to prepare for 14 CASES. The system is broken :(
@MiketheNerdRanger
@MiketheNerdRanger 3 года назад
My God...
@NickiRusin
@NickiRusin 3 года назад
a brave choice. I hope she perseveres and finds a way to manage this
@_SHIN1999
@_SHIN1999 3 года назад
@jomiloju ayodele how did you even come to that conclusion
@HollowFlight
@HollowFlight 2 года назад
@@_SHIN1999 in the field, and with her qualifications. She forewent a better paying job to be a public defender and had a lower salary as a result. The system allows money to buy lawyers for both the prosecution and defendants, but if you don't have money, you get public lawyers. I imagine there are not many public prosecutors because that would mean someone without the means to afford an attorney is being assigned one to prosecute someone. We all know poor people don't get to sue, who would pay for the lawsuit? That's... the whole point of the problem. Basically
@g.d.graham2446
@g.d.graham2446 2 года назад
Agreed
@wilmcdnu1586
@wilmcdnu1586 4 года назад
The Book Of Exodus Prager u ver. Moses Be like: let my people go Rameses: No that ain't justice it's social justice. Different things lol Moses: seems legit. The End
@KatiCleo
@KatiCleo 4 года назад
oh my GOD XD (pun intended)
@jessm2560
@jessm2560 4 года назад
🤣🤣
@mariamatedei
@mariamatedei 4 года назад
Lmao, this should be a comment on their video
@alexturlais8558
@alexturlais8558 4 года назад
Saying free the jews is racist because everyone should be freed. That's not justice, its social justice.
@jordana934
@jordana934 4 года назад
by their logic, wouldn’t they have approved of jesus being crucified? like, since that was the legal punishment for his actions?
@starsoflight
@starsoflight 4 года назад
Wow. I never thought of it that way.
@tereziamarkova2822
@tereziamarkova2822 4 года назад
But that was back when the justice system was flawed I guess, and ours completely perfect or something. Like, you can't improve or critize it, that would be blasphemous. At least that's what their defence is.
@ce7.0
@ce7.0 4 года назад
They approve of Jesus being crucified every time they defend a cop killing an unarmed person today. "As you have done unto the least of these, so you have done unto Me."
@peterprime2140
@peterprime2140 4 года назад
I mean, don't most Christians approve of Jesus' crucifixion as Jesus accepted it and it cleansed humanity of it's sins?
@tereziamarkova2822
@tereziamarkova2822 4 года назад
@@peterprime2140 Yes, but they still consider the trial unjust. The fact that Jesus subjected himself to such indignity makes his sacrifice even greater. At least that's my interpretation - I don't know what the actual doctrine is, I am not a christian, let alone a teologian.
@coglineerro730
@coglineerro730 3 года назад
*Prager U voice*: Imagine this nightmare world where the Justice system considered why someone broke a law and how to put them in a situation where they won’t break that law again rather than just locking up everyone who shoplifts or acting out.
@g.d.graham2446
@g.d.graham2446 2 года назад
Surprise 🙄
@eclogite
@eclogite 2 года назад
They did that in another video, too: "imagine this crazy dystopia where the left wins everything, private health insurance is abolished and replaced with national health care, UBI is standard..." Hmm yes that sounds nice actually
@edwinamendelssohn5129
@edwinamendelssohn5129 2 года назад
That's blame shifting. No one makes anyone commit crime
@aarasko
@aarasko 2 года назад
absolute nightmare /s
@dylanger1015
@dylanger1015 2 года назад
@@edwinamendelssohn5129 there are plenty of scenarios where people are forced into places where they need crime. And anyone could end up in that type of situation. The fact that we don't think about that, kind of crazy to me. I don't think you're wrong to think this is blame shifting. Because at the end of the day it is if you think too black and white "innocent" or "guilty" this thought can crop up in your head. Some people are bad people that need to be locked up, people who's mindset is only to hurt. but not everyone is like that, right?
@Hlast1
@Hlast1 4 года назад
I don't understand PragerU's argument about justice in relation to Christianity. The entire point of the religion is that mercy triumphs over justice, that people are not getting what they deserve. Have they even read what they claim they're following? The point of Jesus dying is to forgive our sins. In their video, they claim that justice supersedes compassion. The literal exact opposite of that is true in Christianity. It's one of the major sticking points people have with the religion, in fact. Radical mercy is really hard to come to terms with, especially when you think of it in regards to rapists or mass murderers. Not arguing for or against radical mercy here, just pointing out PragerU's failure to notice the central idea of what they claim makes the basis of their morality.
@jordana934
@jordana934 4 года назад
they cant read
@alienhoboszombies
@alienhoboszombies 4 года назад
'Have they even read what they claim they're following?' Welcome to America, my dude.
@leekeater1527
@leekeater1527 4 года назад
which Christianity though, that is the question
@tomorbataar5922
@tomorbataar5922 4 года назад
The way I see it PragerU's values are firmly rooted in prosperity theology. When you believe that successfull and prosperous people are that way because of the literal will of god, and poor and marginalized people are unfaithful and disfavored by god, mercy probably won't be very important to you. If god has already judged those people to poverty, why go against that and show them any mercy?
@thegreen2504
@thegreen2504 4 года назад
Lol there’s literally the story of Jesus stopping the “just” stoning of the adulterous woman. Conservatives are anti Christian Christians
@Rycluse
@Rycluse 4 года назад
Only brave warriors like PragerU will fight for the advancement of the groups that have literally every advantage in society
@MrKstate21
@MrKstate21 4 года назад
Somebody HAS to do it
@useroffline9999
@useroffline9999 4 года назад
but.... who will think of us rich white men???? 😢😢 (before anyone comes for me, i know, i know, white men can struggle too. duh. it was a joke)
@kaylaisnothere4397
@kaylaisnothere4397 4 года назад
Straight white cis people have it the worst because we call them out for having immense privilege. Cmon feel bad for them guys, they really need the support and validation 🥺🥺🥺😢😭.
@sambutler9705
@sambutler9705 4 года назад
They put their time in and pay 90 percent of the taxes yes the 10 percent pay 90 percent ps I'm a middle class son of a teacher
@sambutler9705
@sambutler9705 4 года назад
If socialism is good break your leg and try to get healthcare in Canada or any other socialist marxists or communist country
@nimrodery
@nimrodery 3 года назад
"The meek shall inherit the Earth." "No social justice in the Bible."
@rickrolld1367
@rickrolld1367 3 года назад
"The meek shall inherit the Earth" COMMUNISM IS WHEN BIBLE!!!1!!
@aquagrip6876
@aquagrip6876 3 года назад
“Give justice to the weak and the fatherless; maintain the right of the afflicted and the destitute,” (Psalm 82:3). “Learn to do good; seek justice, correct oppression; bring justice to the fatherless, and please the widow’s cause,” (Isaiah 1:17). “He has told you, O man, what is good; and what does the Lord require of you but to do justice, and to love kindness, and to walk humbly with your God?” (Micah 6:8). “But woe to you Pharisees! For you tithe mint and rue and every herb, and neglect justice and the love of God. These you ought to have done, without neglecting the others,” (Luke 11:42).
@domeplsffs
@domeplsffs 3 года назад
Thank you very much sir, i was looking for this comment. Yes yes, the teachings of peace and self-sacrifice are the best basis for people wanting to legaly steal my money.
@MiketheNerdRanger
@MiketheNerdRanger 3 года назад
These PragerU idiots haven't even *read* the Bible.
@jose-qp4yz
@jose-qp4yz 3 года назад
yeah i was like: hasnt she read The Beatitudes? plus, probs cos i was required to take a lot of Catholic Theology, it was hammered into to me that the Church is a Church of the Poor
@calebqueen5631
@calebqueen5631 4 года назад
Sad thing is, is this makes my Christian identity look fundamentally stupid and inherently ignorantly rightist when in reality the idea of Jesus is literally all based on the concept of social justice. So frustrating
@PlatinumAltaria
@PlatinumAltaria 4 года назад
Hey, it's never too late to stop being religious.
@leviangel97
@leviangel97 4 года назад
I think "American Conservative Christian" is a useful term to lump their brand of christianity. It's a way better term than "Judeo-Christian".
@zubzerrolastname6599
@zubzerrolastname6599 4 года назад
PlatinumAltaria not the place dude.
@lordblenkinsopp1537
@lordblenkinsopp1537 4 года назад
I’m Muslim. Keep following the word of God and what is morally right. Be thankful to God, but remember that stuff in the Holy Texts is thousands of years old and so cannot be perfectly applied to the modern day, and so do what you believe God would want. PragerU and Dennis the Menace Prager, who is a racist homophobic greedy corporate sellout bastard are always wrong, and will be. They are the sinners. Stay true my friend
@martaszabo465
@martaszabo465 4 года назад
Right?? It feels like none of them read the gospels, just the first part of Romans where Paul goes on an angry homophobic rant, which is basically just his fanfic imo.
@ionlyed5426
@ionlyed5426 4 года назад
“Again I tell you, it is easier for a camel to go through the eye of a needle than for a rich person to enter the kingdom of God.” - Matthew 19:24
@joelwilcox5424
@joelwilcox5424 4 года назад
Do what is just and right. Rescue from the hand of the oppressor the one who has been robbed (Jeremiah 22:3)
@joelwilcox5424
@joelwilcox5424 4 года назад
go, sell what you have and give to the poor (Matthew 19:21)
@sagedraws1000
@sagedraws1000 4 года назад
Deutschland Über Alles You don't need to be Christian to understand, just to be literate.
@joelwilcox5424
@joelwilcox5424 4 года назад
Deutschland Über Alles but... I am Christian. You know who else was Christian? Saint Ambrose one of the founding figures of the church who said 'the superfluous property which you hold you have stolen'. Also the Liberation Theologians. But also what Tammy said.
@okidokii2871
@okidokii2871 4 года назад
@@basedtvrk9125 was machst du mit diesem namen hier wtf
@TheRealProcyon
@TheRealProcyon 2 года назад
I find it funny how at 12:29 a text from PragerU appears about "leftism" and that it says "the weak are good" and "the powerful are bad" while those are literally two of THE messages of the Bible
@noahvance6160
@noahvance6160 8 месяцев назад
They must be basing their version of Christianity on prosperity gospel.
@thegoodprince3264
@thegoodprince3264 7 месяцев назад
I was about to comment this glad I saw yours first. “Blessed are the meek, for they will inherit the earth.” - Matthew 5:5
@kevinw712
@kevinw712 5 месяцев назад
I saw a rare non-insane christian pastor make a tweet a few months ago about how some MAGA members of his congregation approached him after one sunday's sermon all hot and bothered saying "where'd you get all the liberal talking points?", and he was literally just quoting some scripture as is
@alexf225
@alexf225 2 месяца назад
"Whoever oppresses the poor to increase his own wealth, or gives to the rich, will only come to poverty" Proverbs 22:16, I'm not a christian but some of the bible quotes about rich and poor are pretty neat.
@bullsquid42
@bullsquid42 3 года назад
The notion of the "leftist vs Christian values" is straight up disturbing. It equates "Christian" with "right wing". When the hell did the pacifist teachings of a poor middle eastern man become the same as American imperialism? I can hardly imagine a bigger contrast. But this is the reason why conservative Christians love to quote the Old Testament, but will rarely quote Jesus. The Old Testament was all about a "chosen nation" and its leaders. Jesus was about self-sacrificial love. He was murdered by the religious and imperial authorities of his time. If PragerU existed back then, you know they'd be telling us all about Roman values.
@theomegajuice8660
@theomegajuice8660 3 года назад
"The Bible never talks about social justice, stop making inferences about what Jesus meant and just obey his exact words... also Jesus loves Capitalist free markets and guns and you're going to hell if you condone abortion or homosexuality" The Christian right in a nutshell
@evilfrasier2390
@evilfrasier2390 3 года назад
Because Christianity was infiltrated by well-funded rabbinical movements during the Age of Enlightenment and effectively subverted into the politically-motivated Christian Zionism that we are all familiar with today.
@theomegajuice8660
@theomegajuice8660 3 года назад
@@evilfrasier2390 The twists and turns some people are willing to make so that they can blame the Jews for absolutely everything will never cease to both amaze and depress me.
@bloomp9676
@bloomp9676 3 года назад
Jesus was chill, his followers centuries later are not
@breadtubediet1524
@breadtubediet1524 3 года назад
Christianity is just under 2000 years old at this point and it's most influential early voice is *arguably* NOT Jesus but Paul. Jesus doesn't author any of the books of the New Testament, but almost half are attributed to Paul and almost a third are actually written by him. Now Paul was a progressive of his time but the point is just to say that Christianity has always been farm more than the "pacifist teachings of a poor middle eastern man". It has had more than 15 centuries of institutional power as the theocratic center of the Western World and institutional power is essentially incompatible with Jesus' messages. So the Church has had 15 centuries to expand its theology and its practices beyond the original scope of Jesus and the old church fathers to make sense of its institutional power. The Church of Jesus has always been a largely conservative organization, as would any organization that has held that much power for that long. Jesus only preached for 3 years before he died, that's nothing in the face of the Church's history after him. The fact his message is relevant at all to any Christians or any Christian organization is a feat itself.
@theshortestcharles6886
@theshortestcharles6886 4 года назад
"The great battle of our time is between Judeo-Christian values and leftist values" Well that escalated quickly
@TTTristan1
@TTTristan1 4 года назад
- Half the world's currency owned by a couple people? "Waswrongwithat?" - Over $1.90 a day technically over the poverty line? "We all made nothing at one point or another" - All non-Christian religious peoples and organizations are regularly discriminated against? "Well, they're either terrorists, weirdos, or Jews" - Progressive leftist ideology exists "DEFCON 1 ALERT!!! RETALIATE IMMEDIATELY!!! NO MERCY!!!"
@aaronpettit3813
@aaronpettit3813 4 года назад
I didn't realize it when I was growing up in a private, Christian school, but these days I hear 'Judeo-Christian Values' for the right wing theocracy dogwhistle that it is, and walk away. Although admittedly sometimes they just mean 'Abrahamic but not Muslims'. Not that it's any better that way.
@KingBobXVI
@KingBobXVI 4 года назад
Ah yes, the "great battle of our time" is between a loosely conceived concept and a completely undefined concept. "The great battle of our time is between people I like and people I don't like"
@mariamatedei
@mariamatedei 4 года назад
I've read enough Jewish people on the internet claiming this "judeo-christian" group against outsiders idea is a lie, as in, it's just Christians with entitlement issues dragging Jews along just to feel or sound slightly more legit
@lucassantossj
@lucassantossj 4 года назад
@@mariamatedei Just to not be called "antisemites".
@laellopez3883
@laellopez3883 3 года назад
Also just a small footnote from a Jew here. Judeo-Christian isn't a thing.
@AshiwiZuni
@AshiwiZuni 3 года назад
Thank you! Using that term is for the express purpose of disguising anti semitism in a thin veil of dogshit rhetoric. And to keep people from in their view “cherry picking” their own religious texts.
@squibble311
@squibble311 2 года назад
that reminds me of that one time someone used "judeo christian" when talking about christmas. christ. mas. its so dumb.
@JoaoVVTP
@JoaoVVTP 2 года назад
@@AshiwiZuni Also, using it to say "Abrahamic" (as in religions that believe in God / come from Abraham and his sons as the Jewish, Christians and Muslim do / are), but not wanting to include Muslim people into that because "Middle-East bad and terrorist"
@mammoneymelon
@mammoneymelon Год назад
i genuinely have no idea what that's supposed to mean 😭 i get that Christianity and Judaism have the same origins but it almost never has anything to do with what someone is talking about
@None-Trick_Pony
@None-Trick_Pony Год назад
Judeo-Christians beliefs ARE a thing. They're the beliefs you and I, a Christian, share. These include and are absolutely, 100% limited to: •There is a God •He exists •He is good •Some guys said He was good, but precisely who, when, and how it was said He was good and what qualities He had that made Him good are not in agreement among Judaism and Christianity and are therefore not subject to the shared beliefs persuant to the strict standards and foundational principles of the "Judeo-Christian" moniker •Things happened in the past, of which many relate to religion •??? •There is a God, who does, in fact, exist •That God is, in fact, good • • That's the complete list-no exceptions, no abridgements! Now you know what Judeo-Christian means! Hoped this helped! :) EDIT: I realize I should make this absolutely clear: this is a joke. I don't know if this translated; my jokes aren't known for landing without breaking a half-dozen bones. In all seriousness here, unfortunately I can't offer any real insight into what the heck Dennis is rambling on about. Whatever the origin behind "Judeo-Christian" is, it's clearly not evident to Jewish people _or_ Christians.
@michaeldemarco1465
@michaeldemarco1465 4 года назад
"The Bible doesn't say that..." well, the Bible wasn't written in English, so...
@DerAbsender
@DerAbsender 4 года назад
Now I remember the famous scene from the bible, when Jesus invited the wealthy in the temple.
@sjs9698
@sjs9698 4 года назад
and said 'it is easier for a rich man to enter heaven' because god loves greed.
@EE-gv9wt
@EE-gv9wt 4 года назад
You first have to come to terms with the fact that jesus and gop jesus are not the same guy. Jesus healed lepers, gop jesus only heals lepers with in-network insurance but only after he orders 50 unnecessary and invasive tests to maximize profits
@oldishandwoke-ish1181
@oldishandwoke-ish1181 4 года назад
Yes I believe Jesus sat down with those money-changers and broke bread with them, praising their "free" market principles .....
@austinturner8373
@austinturner8373 4 года назад
@@sjs9698 'you sir you made my day have a cookie
@derekwang7330
@derekwang7330 2 года назад
He did eat with Pharisees
@grisflyt
@grisflyt 4 года назад
"Distrust all in whom the impulse to punish is powerful."--Friedrich Nietzsche
@weatheranddarkness
@weatheranddarkness 4 года назад
got my vote!
@anthonyhayes1267
@anthonyhayes1267 4 года назад
There's a lot of misinformation about Nietzsche going around. I don't agree with everything he taught, but I wish people wouldn't just instantly denounce him without reading anything about him.
@mayman4255
@mayman4255 4 года назад
@@anthonyhayes1267 Who's opposing Nietzsche? his work is fantastic,although it's abused by traditionalists,even though the death of god doesn't necessarily mean the deconstruction of strange traditions.
@nerveagent1905
@nerveagent1905 4 года назад
Don't kinkshame
@MaddyBlu9724
@MaddyBlu9724 3 года назад
I literally have never heard anyone suggest that we should lessen sentences for people who are poor or marginalized. And I see a lot of very far left discourse.
@vylbird8014
@vylbird8014 3 года назад
And yet we effectively do lessen sentences for people who are wealthy, when many crimes carry a fixed fine. We don't even keep rich people in prison before the trial, with the bail system: Those with wealth can just reach for their bank account and go about their lives untouched while their expensive lawyers look for a loophole, while the lower economic classes either stay locked up without a conviction or have to go into considerable debt at a very high interest rate.
@iexist1300
@iexist1300 3 года назад
It's kinda weird that so few people though of that.
@wellheck1377
@wellheck1377 Год назад
@@vylbird8014i think you mean lessen sentences but YES THANK YOU! if the punishment for a crime is a fine, that punishment is for the poor only.
@vylbird8014
@vylbird8014 Год назад
@@wellheck1377 Corrected. Also notable that corporations can commit crimes, which largely shields the actual people making the decision from the consequences of their actions. Unless they commit a truly outstanding crime, they are safely protected - the company gets fined, or perhaps some sacrificial employees are blamed. Look at the Deepwater Horizon incident for a clear example: A major industrial accident causing eleven direct fatalities and major local environmental damage caused by systemic cost-cutting policies which compromised the safe operation of the facility. BP was found to have committed gross negligence and paid fines and settlements in the billions of dollars - a few percent of their annual revenue. And not a single person is in prison. The corporate entity takes the fall, so the managers who decided to endanger lives in the interest of profit are safe from prosecution.
@midoriasakusa
@midoriasakusa 4 года назад
imagine trying to imply social justice is anti-christian
@jamestheawsome100
@jamestheawsome100 4 года назад
This is what happens when you mix religion and politics.
@literallygaston2489
@literallygaston2489 4 года назад
jamestheawsome100 I mean, religion and politics used to be inseparable for a very long time, why do you think all those European nations converted?
@peterprime2140
@peterprime2140 4 года назад
@@jamestheawsome100 Religion and politics are, have and will always be inseparably linked, this is what happens when you don't actually follow your religion's teachings and just use it to excuse your shitty politics.
@EveryTimeV2
@EveryTimeV2 4 года назад
Imagine trying to empathize with an ideology that is so strange it makes the mind warp in mysterious ways in order to even attempt to make anything coherently fit.
@pestoriusj
@pestoriusj 4 года назад
@@jamestheawsome100 "Social justice" as a term was invented by Christians
@charliekowittmusic
@charliekowittmusic 4 года назад
“That’s why the great battle of our time..” *Oh Boy. Here we go.* “..is between Judeo-Christian Values, and Leftist Values.” *NOW it’s a PragerU video*
@goroakechi6126
@goroakechi6126 3 года назад
As an atheist raised under a Catholic home, doesn’t it say that God creates all humans in his image without exception? To offer justice to the weak and fatherless? I was never quite sure why fascists gather around Christianity...
@moredetonation3755
@moredetonation3755 3 года назад
@@goroakechi6126 Christianity is a convenient pillar to gather fascist support around in preparation for the persecution of non-Christians. Of course, "Christians" quickly becomes "Protestants" and then "Baptists" and then "The Cult of Dear Leader."
@graced4844
@graced4844 3 года назад
that’s it! you broke the evangelical church down to its bare essentials
@ferbyfurben9640
@ferbyfurben9640 3 года назад
hard to disagree with that. i hope we'll win lol.
@goatdeer8403
@goatdeer8403 3 года назад
"Judeo"-Christian values
@laurasweightlossjourney
@laurasweightlossjourney 4 года назад
I like how they act like liberal views and Christianity can’t coexist.
@noahkarpinski1824
@noahkarpinski1824 4 года назад
Especially since since Jesus is more liberal than most Democrats.
@cnking27
@cnking27 4 года назад
The coexistence is what they're scared of. It's why they made this video.
@Cajek2
@Cajek2 4 года назад
I don’t think they can, but then again I think christianity is evil. Satanist, here.
@mayman4255
@mayman4255 4 года назад
@@Cajek2 Satanism is worse lmao
@cnking27
@cnking27 4 года назад
@Jonathon The Egoist good argument
@ian_snow
@ian_snow 2 года назад
For conservatives, it’s always about punishing anyone who doesn’t conform to what they believe people should conform to. It’s not actually about true justice.
@ANDROLOMA
@ANDROLOMA 2 года назад
For conservatives, if you don't look the way they want you to look, you're the enemy.
@ashtonsherrod7824
@ashtonsherrod7824 2 года назад
You're right. I'm a Christian, and I find it sad people on the left and right use Gods word for their gain.
@ismth
@ismth 2 года назад
@@ashtonsherrod7824 I’ve only seen ppl on the left bring up god is to point out the hypocrisy of the right. The left doesn’t use religion to justify its beliefs, from what I’ve seen at least.
@coleselipanov9598
@coleselipanov9598 Год назад
Exactly.
@justanotheranimeprofilepic
@justanotheranimeprofilepic Год назад
I will never understand the want to punish instead of reform. If someone is stealing should we not look at why and attempt to fix it so others may not end up in that situation again? Should we not make those who have done crimes they regret go through being reformed to see how to behave in society?
@TheSLATEcleaner
@TheSLATEcleaner 4 года назад
"Moses is the greatest law-giver in history" *Sad Hammurabi, Urukagina, and Solomon noises*
@HistoricaHungarica
@HistoricaHungarica 4 года назад
BTW it's a stolen valor. God gave those laws. Moses was the postman.
@ShragaMatate
@ShragaMatate 4 года назад
@@HistoricaHungarica THIS. ty.
@WiloPolis03
@WiloPolis03 4 года назад
King Lamoni?
@tomithebunny
@tomithebunny 4 года назад
Fr, Moses didn't even give those damn laws, he got them from gd and delivered the documentation of it basically.
@WiloPolis03
@WiloPolis03 4 года назад
@@tomithebunny Yeah exactly
@0urher0nik0
@0urher0nik0 4 года назад
As someone who has been in the system, and gotten out of it... The system is broken and intended to hurt people. Jail and Prison is flawed by design. If you get arrested and thrown in jail against your will, you can lose everything. Gone for a day and can't contact work? Lost your job. Gone for a few days, missed a rent payment and your landlord couldn't contact you? Lost your home. It's that easy to lose everything by just getting arrested.
@pineforest1442
@pineforest1442 2 года назад
And WHAT’S their compensation? A handful of cash. No ordering your job or landlord to take you back, and no wiping felony charges so you are an innocent person LITERALLY CRIPPLED by the system.
@chevon5707
@chevon5707 4 года назад
That lady’s gonna feel dumb when she gets to the second half of her bible
@torrinmaag5331
@torrinmaag5331 4 года назад
Or the first half. The Tanakh is very social justice focused. Off the top of my head, Leviticus requires the well-treatment and acceptance of refugees.
@maythesciencebewithyou
@maythesciencebewithyou 4 года назад
Actually, Jesus isn't very nice towards other tribes. He's quite tribal and Hebrew centric.
@t5k313
@t5k313 4 года назад
made me genuinely laugh thank you
@nakaimoore6548
@nakaimoore6548 4 года назад
I haven’t read the bible. please explain if you get the chance
@Juggler4071
@Juggler4071 4 года назад
Honestly, when it comes to the Bible that Jesus guy is a pretty fringe character. He's only in about 10% of the book. Sure, he steals every scene that he's in, but he's basically a supporting actor.
@uncannyoutrageous9798
@uncannyoutrageous9798 3 года назад
It bothers me how they always say the perpetrator has to "learn" or "realize" that what they did was wrong. As if they didn't know? As if the purpose of punishment is to give people knowledge and not to make them afraid. It bothers me how we use the same language for that.
@harrygarris6921
@harrygarris6921 3 года назад
Yeah Americans really support retributional justice for criminals. I don't know why. It's the complete opposite of what the Bible advocates for, so you'd think conservatives wouldn't support it. But they do. We also have decades and decades of data from other countries showing that rehabilitational justice systems are not only far more effective, but also cheaper, so you'd think that democrats wouldn't support it either. But many of them still do for some reason. It's the main thing that drives me crazy about this country. Why can't we figure this out?
@americasevilgenius
@americasevilgenius Год назад
It is because simply giving knowledge to people is unlikely to make them change their (bad) behaviors. Fear and--ultimately--violence have a far better track record of forcing that change. Our justice system reflects that reality to a degree, and needs to reflect that reality a lot more.
@Camustang
@Camustang 5 месяцев назад
@@americasevilgenius " Fear and--ultimately--violence have a far better track record of forcing that change." Fear and violence have a better track record than just knowledge ? Sure. You know what else has an even better track record ? Giving people alternative options, thereby depriving them of any incentive to commit a crime. I'll just quote someone else's comment that quite readily addresses what you said, mister evil genius : "Just look around the world. Places that have a less punitive and more restorative approach to justice tend to also have lower crime and lower recidivism overall. the USA is the only developed nation that still practices the death penalty, and how is that faring for them in terms of crime? Clearly nobody commits crimes in the USA for fear of punishment /s beside that, punitive justice only focuses on locking up the criminal after they have committed the crime. So by the definition of how it operates, it can never prevent crimes from happening. In your words, "those that do harm" are still "roaming among us", because you can't lock them up for a crime before they commit it. WOuldn't it be better to invest some resources on measures that are actually proven to reduce crime overall, such as education or social programmes, instead of only on "tough on crime" policies? It's not like policing, or prisons, are free. "
@Knokkelman
@Knokkelman 4 года назад
Can't believe how smug this woman looks while claiming stuff that isn't even remotely true or logical
@GeistInTheMachine
@GeistInTheMachine 3 года назад
I agree that SJWs are usually annoying, but the level of unwarranted smugness and patronization that exudes from a lot of American conservatives (leaving aside their ignorance and inconsistent values) is deeply off-putting. Just look at Shapiro and Trump.
@priscilalopez8957
@priscilalopez8957 3 года назад
she sounds like "caught you, you leftists snowflake. Now let me go kill a criminal because of catharsis but protest against a woman disposing of a bunch of cells because her life will be ruined otherwise, you stupid snowflake."
@DragonXflyer
@DragonXflyer 3 года назад
Evil Begets Evil
@theboombody
@theboombody 3 года назад
@@GeistInTheMachine Don't forget Hannity and Bill O'Reilly. I've been right-leaning for 20 years, but I can't stand their smugness. I used to like Hannity's show when it was balanced out by Colmes.
@g.d.graham2446
@g.d.graham2446 2 года назад
Agreed
@duskydancing6409
@duskydancing6409 4 года назад
Ironic, considering the legacy of Jesus was to spend the majority of his time being compassionate towards the poor and oppressed while criticizing the religious leaders, who would later conspire with the governmental justice system to persecute, try, and execute him.
@oldishandwoke-ish1181
@oldishandwoke-ish1181 4 года назад
DuskyDancing Yes..... it's almost as if Jesus was an advocate of ...... 😱 social justice ....
@jdavi6241
@jdavi6241 4 года назад
So basically the cops killed Jesus?
@oldishandwoke-ish1181
@oldishandwoke-ish1181 4 года назад
J Davi Soldiers working for the Roman Empire. Comes to the same thing.
@mimyo1362
@mimyo1362 4 года назад
we always love a good prageru roast
@annie_b17
@annie_b17 4 года назад
PragerU Roast King Joel the Great
@coilcreature
@coilcreature 4 года назад
​@@mstech-gamingandmore1827 You didn't have to sneak social distancing propaganda in there. And no I'm not against it per say, I'm just against it when it's forced on people I'm not some salty conservative because if I was I wouldn't be watching this video. My belief is that humans are 100% responsible for the chaotic state their world has been in recently and if we had just let the virus run its natural course in the first place we would, as a species, come out stronger then ever
@goatdeer8403
@goatdeer8403 3 года назад
@@coilcreature What the fuck lol
@randomdude-4353
@randomdude-4353 2 года назад
"You never see the word socal before justice in the bible" It's almost like it's a modern idea that was created in response to injustices created long after the books of the bible were written
@Hirundo-demersalis
@Hirundo-demersalis Год назад
Capitalism and communism weren't mentioned in the Bible either, yet for some reason people seem oddly obsessed about finding ways to justify unregulated free markets and denounce its alternatives with religion.
@baintreachas
@baintreachas Год назад
i mean, concepts analogous to "social justice" (and injustice) definitely existed back then and are extremely prominent in the bible (bc how would they not be).... it's just that "social justice" is a very specific Modern English expression and the Bible was not written in Modern English
@vacantvisionary
@vacantvisionary 4 года назад
"Judeo-Christian values" always makes me so mad. So much of what's called Judeo-Christian are just Christian values projected backwards onto Judaism, and the fact that some right-wing Jews have bought into this nonsense just proves the power of hegemonic Christianity. The point of connection that Christians will claim between Christianity and Judaism is the Tanach (what Christians call The Old Testament). As written, it does say a lot of shitty, right-wing things. But while Christianity took their holy text and turned it into dogma, Diasporic Jews have always considered the Tanach a living document. Rabbis have studied and debated and rewritten the meaning of the Tanach countless times over the centuries, building up layers and layers of new interpretation in order to cope with a changing world and a changing sense of morality. When Christians assume Jews directly follow the laws of the Tanach, they ignore the two millennia of commentary and precedent that shaped Judaism into what it is today. (One final note: the Rabbis were actually very concerned with social justice! They just had a different name for it - "Tikkun Olam," lit. "Repairing the World.")
@aliceche714
@aliceche714 4 года назад
Thank you for the comment! It's better than I could write the same thing.
@AnkhAnanku
@AnkhAnanku 4 года назад
“Repairing the World” Holy shit, that’s an awesome term.
@SatyaVenugopal
@SatyaVenugopal 4 года назад
@vacantVisionary I've never heard of Tikkun Olam before. Could you please recommend some good resources for me to learn more about it? Thanks in advance!
@tand0r
@tand0r 4 года назад
Fuck I wrote basically the same thing and then scrolled down to see this.
@mr.starfish4965
@mr.starfish4965 4 года назад
Not even Christian values really, just Western Conservative Christian values.
@hindigente
@hindigente 4 года назад
"The Bible does not mention a concept created several hundred years after it was written, therefore said concept cannot be 'in accordance to' Christianity." Same goes for Capitalism; the English language; the Internet; etc.
@rodawallace
@rodawallace 4 года назад
Thankful porn pre-dates the bibble!
@noahkarpinski1824
@noahkarpinski1824 4 года назад
@@rodawallace Spends hours looking at ancient vases showing people having bizarre sex.
@cnking27
@cnking27 4 года назад
The Bible is actually a really good resource supporting social justice, though, and countering capitalism. It's why they picked such a shitty half of a sentence and went with it as if it self-evidently proved their argument. That very chapter talks about oppression, and that verse is God offering compassion to the nation if they will stop oppressing. It says the exact opposite of what they claim.
@kbolternorris2676
@kbolternorris2676 4 года назад
I hate that argument, "jesus couldn't have been a socialist because the word didn't exist back then!!1!!!!11" yeah sure, then let's forget neardenthals even existed since they didn't have a name back then
@cnking27
@cnking27 4 года назад
@Krónika "There are six things that the Lord hates, seven that are an abomination to him: haughty eyes, a lying tongue, and hands that shed innocent blood, a heart that devises wicked plans, feet that make haste to run to evil, a false witness who breathes out lies." There are more verses that call "false scales" an "abomination" than men sleeping with one another, and there's plenty of linguistic, contextual and archeological evidence that "men lying with men" is a reference to pedophilia and rape, not consensual relationships.
@dubitataugustinus
@dubitataugustinus 4 года назад
I hate it when they say "Judeo-Christian" values. The values of both traditions are extremely different, and there's a gigantic amount of Christian people compared to Jewish people, in the world, and in the US, and in Prager U. It's just Christian values, folks.
@Avrysatos
@Avrysatos 4 года назад
I think they say this so they can focus on the old testament stuff.
@redlightmax
@redlightmax 4 года назад
Doctor Speedweed 👍 2:05 I get that there's the Christian right, but I find that Jews are usually on the left - Bernie Sanders comes to mind. "Christian values vs. Judeo-leftist values" would make more sense.
@gemmagomez3556
@gemmagomez3556 4 года назад
I agree, my best guess is that they really mean "non- or anti-muslim" unfortunately.
@ComradePhoenix
@ComradePhoenix 4 года назад
As a Christian, Prager U doesn't represent my values, and I wish people would stop conceding far right bigotry and other nonsense as "Christian values".
@BringerOfBloood
@BringerOfBloood 4 года назад
It's like "European culture" - they just arbitrary group things together, since the actual purpose of the grouping is in what it excludes not what it includes.
@octopodesia3317
@octopodesia3317 Год назад
Lawyer here, you *always* take context into consideration. It's called "intent" and it's like the biggest piece of criminal law
@cosmodious1755
@cosmodious1755 4 года назад
Every time Prager U says Judeo-Christian it's worth remembering that the term was used to try to tie Christian identity to Jewish identity so Christians would maybe not be so open to doing a fascism.
@lafuffarosa562
@lafuffarosa562 4 года назад
I think they do that because in this way they can better support their very conservative policies
@fionatastic0.070
@fionatastic0.070 4 года назад
And to exclude Muslims by not just saying Abrahamic
@andrewboyko8304
@andrewboyko8304 4 года назад
Philosophy tube just dropped his vid on antisemitism, this and Joel are really popping up my week.
@goosgasgas4862
@goosgasgas4862 4 года назад
@@lafuffarosa562 I think it's a little deeper than that. The term "Judeo-Christian values" feels like an attempt by jewish conservatives to try and join the club of their fascists christian counterparts, while ignoring how much they have hated them (and for the most part still do). "We are all on the same team, we all have the same values, even if you think we control the world and you want us dead. Now, the muslims, those are the real bad guy here."
@rust44
@rust44 4 года назад
fionatastic0.0 Even though all three of these religions are just offshoots of each other
@Nudgarrobot
@Nudgarrobot 4 года назад
"Justice is when we get what we deserve" That's even funnier as their working definition given that Biblical theology is entirely predicated on *unjust pardons for their sins in life through the death of Jesus* From a Christian viewpoint, were we to consider God as purely a god of justice, then Jesus would never have had a need to exist, and anyone who sinned (Read: Everyone) would simply be judged for that sin and not go to heaven (Which defaults you to hell. Unfortunate.) The fact that PU tries to make its positions religious and then fails spectacularly, clashing with the *very core of the religion itself* is just mindmeltingly silly.
@michaelt.5672
@michaelt.5672 4 года назад
It would be funny if it weren't so horrifying.
@theblandcharlie822
@theblandcharlie822 4 года назад
What about purgatory?
@Nudgarrobot
@Nudgarrobot 4 года назад
@@theblandcharlie822 Purgatory isn't ever implicitly or explicitly mentioned Biblically speaking, not to mention that PU is a heavily protestant, bible-belt Baptist angle, so the Catholic concept of purgatory is highly unlikely to be considered by their position.
@theblandcharlie822
@theblandcharlie822 4 года назад
@@Nudgarrobot ah..
@carolyntalbot947
@carolyntalbot947 4 года назад
I really like your calling them "PU." Seems so obvious now, but the subtle dig is just
@oliviacorps4799
@oliviacorps4799 4 года назад
Wow, I'm speechless. I'm a devout Christian and the channel you're talking about makes me want to sob. Jesus would have been considered very socialist in the way he treated others if he were on earth today. PragerU is ridiculous.
@MalevolentMonkeyGod
@MalevolentMonkeyGod 4 года назад
It’s been a couple of months. How do you feel now? Genuinely interested. No judgement. Full disclosure, I’m completely areligious (not a word I think). Can’t get my head around faith at all so I miss a lot in these discussions
@Debilitator47
@Debilitator47 4 года назад
Hello fellow human. Like Avi, reaching out. Hope you see this. The answer is that religion, and christianity in particular, can be used for good or ill. It is a human's prejudices that decide what messages they see in scripture. If one believes that genetics determines criminality, empathy, intelligence, and other traits, then one might read the bible as pragerU does. On the other hand, if one reads study after study showing that one's environment, access to nutrition and varied educational experience plays a huge part in how one forms later in life, one might indeed heed to the socialist values espoused. I myself am not religious in any sense, and only vaguely spiritual. I believe humans can decide for themselves to be empathetic to others, or to close themselves in rigid dogmatic thought. It doesn't require a divine being to say 'be good'. We can observe the effects of our actions on others, and choose to do the things that help each other. Edit: Spelling.
@guilhermegoldman
@guilhermegoldman 4 года назад
That's just one of the reasons I don't like "jesus". If he ever existed, he was a commie.
@willywonka7812
@willywonka7812 4 года назад
@@guilhermegoldman Communists are good though. Compared to Capitalists, at least. And compared to you; a worm
@guilhermegoldman
@guilhermegoldman 4 года назад
@@willywonka7812 you know you're going to hell, right, Willy? You're rich as fuck.
@kai_plays_khomus
@kai_plays_khomus 3 года назад
There is one argument against death penalty which should convince any sane human: somebody who is innocent can falsly be sentenced to death. If he would be sentenced "just" for life instead there would be at least a chance that someday he is found out to be innocent and can get free, receiving compensation. If he is instead sentenced to death right away it might be too late, or it never gets figured out at all. A system which risks to kill just one innocent for punishing the guilty in the hardest way possible (even when it might be unlikely - which it isn't) is deeply flawed and immoral.
@NotSomeone68
@NotSomeone68 3 года назад
Go beyond that. There is a reason against the death penalty that is purely capitalist and beyond any compassion. It simply costs less to give someone life in prison than to put them on death row. That shows its for no reason beyond revenge and cruelty.
@kai_plays_khomus
@kai_plays_khomus 3 года назад
@@NotSomeone68 I said it was an argument to convince any *sane* human - but you are absolutly right: we know that the pro-life death cultists are not part of this category, so it might be more helpful to argue with solely monetary reasons - after all a monetary reason is a good reason for them. Hell, even russia put a hold on the practice of death penalty, and I'm not aware of any western state besides the US still doing it.
@Nimish204
@Nimish204 2 года назад
Wouldn't that imply that no criminal ever ought to be released because the recidivism rate is never zero?
@kai_plays_khomus
@kai_plays_khomus 2 года назад
@@Nimish204 No, it wouldn't.
@Nimish204
@Nimish204 2 года назад
@@kai_plays_khomus it would. If you believe that even executing one innocent person is too much, to me, it logically follows then, if even one person released after murder commits a murder again, that would justify locking all of them up for life. Because according to you, even one innocent person killed is too much. Now if you believe that executing a person is somehow worse than being murdered, I don't know how you believe that.
@IMatchoNation
@IMatchoNation 4 года назад
"What is justice, you ask? It's whatever we say the Bible says, dummy, stop asking silly questions." - PragerPoo, bastion of learning and critical thought
@lordblenkinsopp1537
@lordblenkinsopp1537 4 года назад
PragerU, basically a shitty TedTalk
@spaghettiofeternaldamnatio6988
@spaghettiofeternaldamnatio6988 4 года назад
Critical thought equals critical theory which equals the frankfurt school which equals neomarxism which equals marxism which equals nihilism which is against god so free thought is a sin
@Tinkering4Time
@Tinkering4Time 4 года назад
“Judeo-Christian” is a term used by Christians mainly. Judaism and Christianity are so wildly different at a fundamental level that only people who use that term are trying to evoke an aura of authenticity and antiquity that is at odds with their own doctrines and histories.
@sholem_bond
@sholem_bond 3 года назад
yes and also (in addition to the very real theological differences in approach to "sin" and "redemption," plus the stated goal of following each religion; in Christianity, it's to free yourself from sin and avoid Hell, while in Judaism it's to live the most ethical and holiest life you can in observance with your covenant with God and following/studying His word), it's a bit fucked up to claim we're basically the same group when Christians spent literal centuries being violently anti-Semitic.
@Mish844
@Mish844 3 года назад
it's invokes the anathomy of bullshit aka Deepack Chopra, PragerU, Jordan Peterson, examples: cultural marxism, postmodern neomarxism
@HeadCannon19
@HeadCannon19 3 года назад
"Judeo-Christian" is just PragerU wanting to say "Abrahamic" but not wanting to include Islam
@AammaK
@AammaK 3 года назад
It's actually pretty widely used in theological academics and religion studies, like exegesis and even archeology, when describing pre-church era where there was no clear division yet. Most Jesus' followers were Jews and they were essentially a sect. It's even a bit anachronistic to say "Jewish" because there was no such category as religion, hence "Judeo" refers to the etho-cultural position of that part of the Roman empire population as people, not necessarily members of a distinct religious tradition. Scholars of any background rarely speak about "Judaism" before the destruction of the second temple when the service in Jerusalem started to fade and the tradition sifted to synagogues around rabbinic lead, and the new literate traditions of Midrash and Talmud. In same way "Christian" should not be understood in this context as a modern type of organized religion, it was a movement comparable to ancient mystery cults popping in and out of existence those times. It's literature expected the hearers to have wide knowledge of Judean heritage and culture and it's forming theology tried to answer to both Judean monotheistic and Greek philosophical problematics. "Judeo-Christian" means not only did Christianity rise from Judean lineage but Christ followers also had an influence on the formation of post-temple Judaism. After all they were both minorities in the time of Roman governance. The term is also a way to describe the formation of Mediterranean culture in cross pressure of Greek philosophy and Judean monotheism under Roman rule. It doesn't try to give a statement on Abrahamic tradition, because there was no such thing that time, That's way later. One last thing needs to be said, and that's the fact that after canonization of the scripture the "Judeo-Christian" influence refers to the role of both Old and New testament in European culture. Even though Christianity started reading the Tanakh with cross shaped classes, the influence of Judean tradition and world view was there shaping the Christianity centered culture of European areas through the textual mythos. We need to remember that at that point the different faith groups were fairly separated and Islam doesn't really play a part here yet before 8th-10th centuries when Muslim led political influence starts spreading around Mediterranean. This is not to say they are using the term correctly. They absolutely are not. It simply doesn't apply there. What they are trying to stress is the value of written law as a basis of religious understanding of justice, but the conclusion is horrendous, which makes it at least offensive to refer to such cultural category as any sort of valuable argument.
@MehWhatever99
@MehWhatever99 3 года назад
Yes! I hate the term Judeo-Christian. It has nothing to do with Judaism.
@steveng6704
@steveng6704 4 года назад
This happened to a friend of mine, they acted in self defense, stabbed the attacker with a knife, and then called the police. But the DA charged them with attempted murder. They couldn't afford a lawyer as they had a minimum wage job, and their public defender talked them into taking a 6 month jail time plea deal for felony assault with a deadly weapon charge.
@coleselipanov9598
@coleselipanov9598 Год назад
woah. And here I was thinking the Law was supposed to be fair and just....I'm truly sorry about what Happened to your friend. We live in such an unjust world.
@brownwater6212
@brownwater6212 4 года назад
I can see Joel is slowly losing his mind having to watch Prageru.
@pouncerlion4022
@pouncerlion4022 4 года назад
Anyone would. Look at the loss of sanity those who make and edit the PU vids go through. Tragic, just tragic.
@olegsagaydak1898
@olegsagaydak1898 4 года назад
Pouncer Lion Or look at YTPs of PragerU, these people are lost causes
@SCWood
@SCWood 2 года назад
What's hilarious about PU pushing "Justice = you get what you deserve" while trying to play it from a Christian angle is that by God's very definition, everyone is a sinner who deserves to rot in hell, and Jesus' death and redemption of humans is not justice, but grace. Jesus literally goes against PragerU's definition of justice.
@ThePainkiller9995
@ThePainkiller9995 4 года назад
imagine being the kind of person who watches prageru and goes "hmmm yes this makes a lot of sense yes clearly"
@foxcheetah6035
@foxcheetah6035 4 года назад
I was for a bit, actually, until I looked further into it and realized they barely ever mentioned their sources, and what little they did mention was often heavily biased and unreliable. I tried to use one of their videos as an essay source, and then I realized that, despite the fact that the video said "studies show," I couldn't find any materials aside from the video that contained those studies, much less actually showed their results. Psychologically, it's easy to fall into that shit.
@TokkyuMidori
@TokkyuMidori 4 года назад
@@foxcheetah6035 Good on you for getting out using logical reasoning. Misinformation like that is specifically designed to trap people, even people like you who are capable of seeing through such bullshit. It's everyone's responsibility to look out for such traps and not fall into them, because pretty much anyone is capable of falling for misinformation campaigns like PragerU.
@DIGITALGH05T
@DIGITALGH05T 4 года назад
@@foxcheetah6035 i stopped being friends with this one guy cuz he kept spamming me with prageru vids...also at one time he spammed me with straightup porn...and also possesses no critical thinking capabilities and called me a liberal because i was angry he didnt agree with me but in reality i was angry because he chose to be illiterate.
@emily16173
@emily16173 4 года назад
Geez, even in their own internal logic they're just gonna blatantly ignore all the times mercy is also mentioned in the Bible....you know "Blessed are the merciful: for they shall obtain mercy" and "Be ye therefore merciful, as your Father also is merciful." Not that I'd expect anything less from PragerU.
@herefortheshrimp1469
@herefortheshrimp1469 4 года назад
All that stuff about how great charity and forgiveness and literally NOT BEING RICH (something about a camel through the eye of a needle) are great too? Apparently that's not relevant
@leekeater1527
@leekeater1527 4 года назад
@@herefortheshrimp1469 Matthew is rarely taken as a moral guide by Christians. there are actually quite a number of arguments against Matthew and for John
@weatheranddarkness
@weatheranddarkness 4 года назад
This reminds me of the time i got into an argument with one of these christianoconservacucks and brought up the beatitudes. Sumbitch nearly spat in my face. Apparently in some schools of thought The Beatitudes are essentially apocrypha.
@KrazyKarl910
@KrazyKarl910 4 года назад
@@leekeater1527 1) what are these arguments and 2) how is the morality of John any different?
@avacadotoast5492
@avacadotoast5492 2 года назад
Oh no. Isn't this the woman that talked to Girl Defined about her book "Your not enough and that's okay" where she says crap like self love is evil and sh-t? These people are legitimately crazy.
@sushigivesmelife2131
@sushigivesmelife2131 2 года назад
Well, because you're not supposed to like yourself - you are only supposed to like Jesus and God and literally no one else
@pissapocalypse
@pissapocalypse Год назад
Girl Defined is absolutely unhinged and not in a good way. They have some of the worst takes I've ever seen in my life, and I've seen a lot of bad takes.
@gaowuji2091
@gaowuji2091 4 года назад
The fact that you are subjecting yourself to prageru videos makes me feel like I should pray for your soul.... And I'm an Atheist.
@da_pikmin_coder8367
@da_pikmin_coder8367 4 года назад
Conservatives: "The media unfairly favors blacks. They hold George Floyd up like a martyr, without even asking about Chauvin's side of the story." Me: "Yeah I'm sure George Floyd feels very priveleged SIX FEET UNDER THE GROUND. I'm pretty sure if George Floyd had to choose between being alive and Joe Biden attending his funeral, he'd choose being alive."
@trentonmcclintock7836
@trentonmcclintock7836 4 года назад
id like a link or a source for where you saw someone advocating for that cops side of the story. personally, I have not seen that once.
@useroffline9999
@useroffline9999 4 года назад
MDL48 no one explicitly side with the cops, but some people like to invoke Floyd’s criminal past, saying “he was no angel” and whatnot. the problem with this is that he already served his time for those crimes, and bringing them up implies that he deserved his fate, whether that’s the intention or notz
@trentonmcclintock7836
@trentonmcclintock7836 4 года назад
@@useroffline9999 nobody is implying that he deserved what he got. what they're saying is that he does NOT deserve all the posthumous worship and elevated status that he has recieved, and that people should not be destroying the country, looting, and killing more people in his name.
@Communistkittens
@Communistkittens 4 года назад
Lostin Thegarden what posthumous worship ? The saying is justice George Floyd. People bring up the fact that he was a father with a young daughter and that’s really about it. People fighting for his rights we’re doing their best to “rehumanize” him after media outlets like Fox News were doing there best to broadcast his past in pornography and possibly drug usage.
@saudade7842
@saudade7842 3 года назад
@@Communistkittens The thing is, you never see reactionaries claiming 'he was no angel' when a white guy is murdered.
Далее
The Nonsense Politics of PragerU | Big Joel
32:15
Просмотров 2,5 млн
КАК БОМЖУ ЗАРАБОТАТЬ НА ТАЧКУ
1:36:32
Шоколадная девочка
00:23
Просмотров 90 тыс.
荧光棒的最佳玩法UP+#short #angel #clown
00:18
The Cult of Dr. Phil | Big Joel
21:16
Просмотров 1,1 млн
Blaire White and the Fiction of Conservative Debate
23:21
MOJITO AND REDDIT TIME WITH BIG JOEL
1:26:27
Просмотров 357
School of Life: A Bad YouTube Channel | Big Joel
25:42
The Right-Wing War on Education
56:20
Просмотров 659 тыс.
Anti Abortion Propaganda | Big Joel
31:16
Просмотров 1 млн
Debunking a PragerU Video About U.S. Immigration
15:31
Просмотров 992 тыс.
300, Fascism, and The Angry Men of Twitter
34:22
Просмотров 1 млн