What is Genomics - Full Length 

We humans have been practicing science for hundreds of years. Thousands of beneficial technologies have changed the way we live. Unfortunately, too few scientific pursuits have lead directly to improving the human metabolism. We are all subject to hundreds of ailments, diseases, and metabolic defects. With the science of Genomics, we now have the chance to greatly improve upon human biology, help to prevent dozens of deadly diseases, and the relieve the suffering of millions.

Great illustration of Genomics. Thanks!

Thank you!

Very nice! THX

Hello could you please tell me which software do you use for these animations

found this very useful. thanks

even for the surfacial curvature of bodies?

very useful to me..

is there any websites that show you the human genome? plz tell me if there are.

very nice, thanks!

can someone provide the proper citation for this video APA 7 format?

I still have no idea what genomics is.....

Hi there, I think there's a mistake on the visual of two copies of genes in the copy number variation section. The two copies should be on the chromosome and its pair not on the same chromosome.

It is the same thing as computer programming/packet sniffing. In computing, you have a byte, which is consisted of 8 bits. Each bytes can be a letter like "A" or "Z". Same method applies in genes. A gene contains a code for a protein or a unknown code consisted of codes of ACTG. Compile that code and then you have a scripture how the human/animal/plant i built. Same with computers, compile your binary code and you have a program.

Well explained 🥰💜🥰💃

Here, after the Ark Invest results in 2020 from Genomics funds.

GATCGAAACTGACTGTTACTGATGCAGTCACTGACTGACTATGACTACTCTACCTGAATTGCTGTACCTAGGGTACCTCAGTTTCCGAAATAGATAATAGTGTCCTATACTTGTATATGTATCTATAGATCGAAACTGACTGTTACTGATGCAGTCACTGACTGACTATGACTACTCTACCTGAATTGCTGTACCTAGGGTACCTCAGTTTCCGAAATAGATAATAGTGTCCTATACTTGTATATGTATCTATAGATCGAAACTGACTGTTACTGATGCAGTCACTGACTGACTATGACTACTCTACCTGAATTGCTGTACCTAGGGTACCTCAGTTTCCGAAATAGATAATAGTGTCCTATACTTGTATATGTATCTATAGATCGAAACTGACTGTTACTGATGCAGTCACTGACTGACTATGACTACTCTACCTGAATTGCTGTACCTAGGGTACCTCAGTTTCCGAAATAGATAAC i ran out of room...

cool vid

nice

I'd love to see an actual human genome mapping.

1:44 3D illusion

I think there might be a grammatical mistake about 1:28, "the cell that houses it TWO factors outside..." shouldn't it be "to" instead of "two"?

It's pretty cool that in 2015 we live in a world in which you can get your DNA sequenced for $99 instead of the $1000 it estimated in the video. Amazing!

Who’s here because of BNGO?

I wanna be a genomist

Anyone here to find out what arkg is about

🐢🐳🐳🐳🐚🐚

The guy who made my lawn Gnome is a Gnomist

I wonder if they thought of making genomic changes with a vaccine. Ask your doctor to read the insert that comes with the bottle.Ask him him if he cares.

put the genome mixing with coconut genome mixing with pumpkin genome mixing with water melon genome mixing with melons genome mixing with mustard oil plants mustard seeds genome mixing with oil production plants genome mixing with rubber plants genome mixing with coconut genome mixing with plum genome mixing with pumpkin genome mixing so we got more edibles and complex compound for fractional distillations and patrol solution become easy forever

okaaaaaaayyy?? I learned nothing from this