Тёмный

Why flat earthers scare me 

Sabine Hossenfelder
Подписаться 1,3 млн
Просмотров 414 тыс.
50% 1

Continue learning more about your favorite topics with Brilliant! First 30 days are free and 20% off the annual premium subscription when you use our link ➜ brilliant.org/sabine.
The flat earther community seems to be growing, and it's beginning to worry me. It's not just a question of lacking science education, there is more going on here.
🤓 Check out my new quiz app ➜ quizwithit.com/
💌 Support me on Donorbox ➜ donorbox.org/swtg
📝 Transcripts and written news on Substack ➜ sciencewtg.substack.com/
👉 Transcript with links to references on Patreon ➜ / sabine
📩 Free weekly science newsletter ➜ sabinehossenfelder.com/newsle...
👂 Audio only podcast ➜ open.spotify.com/show/0MkNfXl...
🔗 Join this channel to get access to perks ➜
/ @sabinehossenfelder
🖼️ On instagram ➜ / sciencewtg
#science #conspiracy #flatearth

Наука

Опубликовано:

 

23 май 2024

Поделиться:

Ссылка:

Скачать:

Готовим ссылку...

Добавить в:

Мой плейлист
Посмотреть позже
Комментарии : 18 тыс.   
@lipsterman1
@lipsterman1 19 дней назад
Social media has taught me two things. First, there are some incredibly brilliant people in the world. Second, they are vastly outnumbered.
@DanielFealko
@DanielFealko 19 дней назад
vastly
@GeorgeSmiley77
@GeorgeSmiley77 19 дней назад
Okay, but I learned that in school.
@craigdavidson2977
@craigdavidson2977 19 дней назад
There is a theory that if you had an infinite number of monkeys pounding on an infinite number of keyboards then eventually just by random chance they will type all the words to the novel "war and peace". The Internet has proven this theory false.
@duran9664
@duran9664 19 дней назад
🚩FACT🚩 Flat earthers r TOTALY right when it comes to the fact that many of space videos & photos r CGs, manipulated or fake; including the ones that get released by NASA🤏
@voidagent
@voidagent 19 дней назад
LOL (Lack of Logic)!
@alandenton1024
@alandenton1024 18 дней назад
Wikipedia says "The Flat Earth Society has members from all over the globe" Now that is what i call humour.
@MR-MR-ud5oo
@MR-MR-ud5oo 18 дней назад
Fake encyclopedia
@Daniel-jm8we
@Daniel-jm8we 17 дней назад
That was the original statement on FE website.
@samrowbotham8914
@samrowbotham8914 17 дней назад
I call it a logical fallacy.
@patrickregan3302
@patrickregan3302 17 дней назад
ROFL😂
@getsideways7257
@getsideways7257 17 дней назад
Golden :)
@haynerbass
@haynerbass 8 дней назад
IF the planet was flat cats would have knocked everything off the edge by now.
@SuckPuppet-xv1dv
@SuckPuppet-xv1dv 6 дней назад
One of my favorite 'conspiracy theories" is that cats are aliens in disguise sent to monitor humanity. Don't worry, tho', they are mostly benevolent.
@neko_neko9
@neko_neko9 4 дня назад
This should have more likes
@Buckdawg
@Buckdawg 2 дня назад
Was funny the first time i heard it. Ten years ago...
@scottfw7169
@scottfw7169 2 дня назад
@@Buckdawg And still is, as the cat here on my computer desk has just knocked my pen off and is now working on the placemat in front of this keyboard ...
@davidgray5570
@davidgray5570 День назад
You are misinformed...the cats are in on the conspiracy!
@dianafarmer5445
@dianafarmer5445 11 дней назад
As an Aussie I'm worried about them too. They said Australia dosen't exist, so I'm worried about where I've been for the last 65 years.
@smeeself
@smeeself 11 дней назад
Now you're opening your sheepy eyes to the TRUTH! Cheers from Aotearoa. 😉👍
@stevenvarner9806
@stevenvarner9806 11 дней назад
Your country also resembles a hot dog in their flat earth models.
@dianafarmer5445
@dianafarmer5445 11 дней назад
@@stevenvarner9806 How lovely😅
@jagobabarron5501
@jagobabarron5501 10 дней назад
Your country is nothing but a huge tv studio in area 51.
@Roybotski
@Roybotski 10 дней назад
​@@jagobabarron5501 uh what
@Martin_Siegel
@Martin_Siegel 19 дней назад
Isaac Asimov said: "Anti-intellectualism has been a constant thread winding its way through our political and cultural life, nurtured by the false notion that democracy means that 'my ignorance is just as good as your knowledge."
@johndonson1603
@johndonson1603 19 дней назад
As much as I know flat earth theory is completely ridiculous, I disagree with that statement, people have the right to hold views that are clearly wrong , it’s their right as human beings , otherwise we end up with free thought and free speech being censored and controlled by those who believe they know better .
@puddintame7794
@puddintame7794 19 дней назад
God save us form the arrogance of the experts.
@iloveitall
@iloveitall 19 дней назад
Brilliant.
@TheSulross
@TheSulross 19 дней назад
that precisely defines the contemporary Woke mind virus
@Vaeldarg
@Vaeldarg 19 дней назад
@@puddintame7794 Actual experts have earned the right to be arrogant. Amateurs arrogantly claiming to know more than the experts have not.
@janthony721
@janthony721 17 дней назад
Flat Earthers have nothing to fear but Sphere itself.
@roberteatwell6827
@roberteatwell6827 16 дней назад
Brilliant pun. Love it. Deserves more recognition.
@TheBreenGene
@TheBreenGene 15 дней назад
Underrated comment for sure
@paulg444
@paulg444 15 дней назад
That one is for the ages !!
@vibaj16
@vibaj16 15 дней назад
@@roberteatwell6827 i mean, it's a _very_ common joke
@paulward4268
@paulward4268 14 дней назад
janthony721. Magnificent.
@NastarNordmire
@NastarNordmire 11 дней назад
One thing that I've seen flat earthers do is find every reason to ignore the findings of their own experiments when they prove that the earth is a globe.
@user-ls1qc8hg2s
@user-ls1qc8hg2s 10 дней назад
“You know, the very powerful and the very stupid have one thing in common. They don’t alter their views to fit the facts. They alter the facts to fit their views.” - The Face of Evil: Part Four (1977)
@shadowshatto
@shadowshatto 9 дней назад
I feel like flat earthers are fearful, I think they are scared of the universe and what it means and just how vast and unknowable it can be. My mom is an antivaxxer and yet she was a nurse and a pretty smart lady, but when you let your fear run away you become irrational and I think scientists laughing off and not taking it seriously will only lead to More of this that will be harder to weed out and fix
@bob_the_bomb4508
@bob_the_bomb4508 9 дней назад
“Interesting…”
@davidhollenshead4892
@davidhollenshead4892 9 дней назад
One killed himself with one of his own experiments, if he was actually being honest about being a flat earther...
@ronpapi9539
@ronpapi9539 9 дней назад
@@user-ls1qc8hg2s is. Donald Trump!
@angryoldcanadian3905
@angryoldcanadian3905 7 дней назад
I work with a flat earther and there is no amount of evidence he will accept. My theory is that these people think that they are 'special' because only they and a few others know 'the truth'. This is important because most of them have done nothing special in their lives and this makes them feel good about themselves.
@pnichols6500
@pnichols6500 20 часов назад
Just like the protesters right now, grasping at relevance.
@MrDominex
@MrDominex 17 дней назад
Flat Earthers don't really care what shape the Earth is, they just want to play a game of one-upmanship by adopting an absurd opinion and then defending it against all reason like a passive-aggressive jackass.
@rivershen8199
@rivershen8199 16 дней назад
Flat Earthers are the type of people who won debating competitions in school no matter how ridiculous the position they had to defend.
@miloszforman6270
@miloszforman6270 16 дней назад
@MrDominex Most probably you're right, but what on Earth drives Hossenfelder to seriously engage with such hoaxes?
@uNiels_Heart
@uNiels_Heart 16 дней назад
@@miloszforman6270 Because flat earthers have an impact on society, especially if their number is on the rise
@TesterAnimal1
@TesterAnimal1 16 дней назад
Some. Not all. Many vehemently believe it.
@mikeguilmette776
@mikeguilmette776 16 дней назад
@@miloszforman6270 Right now, many schools are teaching that boys can be girls, so it's not much of a stretch to think that flat earth "science" could end up in the curriculum soon . . .
@Mozart4000
@Mozart4000 19 дней назад
I watch a lot of flat earth stuff on YT. What I've learned is that flat earthers don't want to learn anything. They just want their opinion confirmed. Anything that deviates from that is rejected.
@knowsomething9384
@knowsomething9384 19 дней назад
"They just want their opinion confirmed" is a common affliction among social media consumers of all kinds, unfortunately.
@iamTheSnark
@iamTheSnark 19 дней назад
Many are able to escape. STST (Seek Truth Speak Truth) is a notable example. Recently, Rachie 00000 escaped, and she is now a debunker. And not even a bad one. FTFE (FIght the Flat Earth) has his own story of many people who saw his videos, and after a while sent Thank You mail to FTFE, helping them escape the nonsense. There must be more.
@Kim_YoJong
@Kim_YoJong 19 дней назад
That's everyone lol
@VonJay
@VonJay 19 дней назад
I remember bumping into an old friend of mine from middle school who was actually in my science class. Really cool guy as we got along really well. We went to Highschool together but didn’t hang out much maybe because we never had any classes together. Years later I bump into him and for some reason we talk about the earth being flat. And we argue for hours and hours and it’s crazy to me think that he’d take such a position. He even used “math” and “science” to try to prove his point. I asked him about the astronaut photos and he said fish eye lens to which I said that’s not how a fish eye lens works. It got to the point where I just said “everything you’re saying is irreproducible in the real world. Nothing you’re saying can lead to any type of invention or (like Sabine said) real world prediction. It can only satisfy your paranoia.”
@ptrinch
@ptrinch 19 дней назад
Flat earthers are more interested in the argument than the science. If you ignore them, they won't get what they are looking for and will eventually go away. Alternatively, in the immortal words of the half dozen people attributed to this quote.... "Never argue with stupid people, they will drag you down to their level and then beat you with experience."
@diedertspijkerboer
@diedertspijkerboer 3 дня назад
I've personally met a flat earther and someone else who thought that making math-inspired drawings was the same as doing maths. The problem in both cases was that they believed that they could figure this stuff out on their own. The flat earther read stuff online and was simply unable to detect bad physics because he didn't know physics. In the process, he was ruining his life by forcing his views on others. I think that the reason why people become flat earthers is that, in their own mind, they've become scientists, while previously, they held or failed at jobs with much less social status.
@ronpapi9539
@ronpapi9539 3 часа назад
No they're debunking scientists who are unable to decipher FE Truth and will do anything to protect their social standing with falsehoods .
@hahahadracula
@hahahadracula 3 дня назад
What I mostly see is that flat earthers have no sense of scale.
@smeeself
@smeeself 3 дня назад
True. But you also didn't need the last two words.
@caravanlifenz
@caravanlifenz 14 дней назад
As a New Zealander, I'm concerned by how dangerously close they've placed us next to the edge of the world where the water drops off 💧😭
@johnkean6852
@johnkean6852 13 дней назад
The flat earth society model is unrepresentative of current flat earth beliefs. Do more research before you spout ignorance.
@russell2952
@russell2952 13 дней назад
No worries. Flat earthers don't have a model. They usually take a polar projection and call that their map, but it obviously doesn't fit any real world observations. As Sabine said, they can't so much as explain a sunrise.
@jacksonknock1833
@jacksonknock1833 12 дней назад
@@russell2952 For real. It always goes like this: - "You still don't have a map" - "Lmao, have you heard of Gleason's? Do your research!" - "None of the distances there seem to correlate with actual real life distances, what's up with that?" And then it's either "It's just a representation, not an actual map" or they just ignore you and pretend the conversation never happened. Same with model. Never seen a flerf take any conversation to its logical conclusion - they always run away.
@cullen3624
@cullen3624 11 дней назад
I have a large wall map of the world and new Zealand isn't even it.😂
@ZlatnoPeroTV
@ZlatnoPeroTV 10 дней назад
Wait, aren't they denying the existence of Australia?
@mintonmiller
@mintonmiller 19 дней назад
Maybe we can get them to compromise. First get them to settle on the idea on Earth being a cube. Then we can gradually round off the edges over time.
@raminagrobis6112
@raminagrobis6112 18 дней назад
😂😂
@johnhough7738
@johnhough7738 18 дней назад
Genius! I love it ...
@paulkolodner2445
@paulkolodner2445 18 дней назад
I think you're on to something here.
@goodtouch459
@goodtouch459 18 дней назад
This or add polygons 😂
@johnjeffreys6440
@johnjeffreys6440 18 дней назад
Ask a flat-earther to call the earth a disc instead of flat. Most won't because the earth is flat from the surface, but not from space.
@edwardvan5808
@edwardvan5808 День назад
The Greeks around 300 BC knew the earth was a globe. So did sailors. And they measured the circumference of the earth using sticks and trigonometry to a 2% accuracy. Pretty cool.
@whichgodofthousandsmeansno5306
@whichgodofthousandsmeansno5306 11 дней назад
There is a VERY wide line between healthy skepticism and reality denial. Flat earthers don't see any line at all.
@ronpapi9539
@ronpapi9539 10 дней назад
Only Flat Lines!ha ha
@eindbaaz3815
@eindbaaz3815 9 дней назад
@@ronpapi9539 I wish they flatlined
@PartlyXenon
@PartlyXenon 8 дней назад
They see a 3D line!
@alkaholic4848
@alkaholic4848 8 дней назад
They see the line, but don't believe it's really a line. It's nasa pretending there is a line.
@ronpapi9539
@ronpapi9539 8 дней назад
@@PartlyXenon No Curved line noted as usual.
@Vohtwomax
@Vohtwomax 18 дней назад
I recently had a....debate with a flat earther. We were proceeding with the discussion up until he told me, AND I QUOTE, “not to use science and logic” when trying to persuade him. So ended THAT conversation.
@godfreyofbouillon966
@godfreyofbouillon966 17 дней назад
Well that was your first mistake. Someone honestly believing in flat earth has IQ of a chimp at best and no reasonable debate is possible.
@MyrKnof
@MyrKnof 17 дней назад
Its because he wont understand it, so he asks you to not talk gibberish. You cant start at that point, because he is too dumb, you need to start at improving his fundamental knowledge of before talking "advanced" stuff like.. simplified gravity.
@k_tell
@k_tell 17 дней назад
He may have fallen for the charlatan Samuel Rowbotham's so called "Zetetic Method". Interesting question to ask someone who actually believes in the Zetetic Method is "What is the Zetetic Method?".
@DragonOfTheMortalKombat
@DragonOfTheMortalKombat 17 дней назад
So what were you supposed to use ? Feelings ? Lol You can tell earth ain't by using very common knowledge
@ryzikx
@ryzikx 17 дней назад
there are non-scientific arguments to convince someone out of flat earth
@Muritaipet
@Muritaipet 19 дней назад
Bob the Science Guy summarised it - "There are two types of Flat Earthers. The ones who believe, and the ones selling them T-shirts"
@MyName-tb9oz
@MyName-tb9oz 19 дней назад
No, there are also the trolls doing it for the, "lols." Years ago when I was on Fecesbook there was a girl on my friends list who I later discovered was a flat-earther. I saw people commenting on her page and I swear some of them were just egging her on to be nasty. I really felt bad for her. It was quite sad and cruel.
@richardalvarez2390
@richardalvarez2390 19 дней назад
There are also those that were always attacking flat earthers with our NASA facts and as we saw through the many lies, we became flat earthers.
@AnirudhTammireddy
@AnirudhTammireddy 19 дней назад
@@MyName-tb9oz I'm confused who are the 3rd type of flat earthers? the girl in your story? But she wasn't a troll in your story?
@Muritaipet
@Muritaipet 19 дней назад
@@MyName-tb9oz LOL @ "fecesbook." I agree there's likely a lot of trolls, pretending to be flat earthers.
@Muritaipet
@Muritaipet 19 дней назад
@@richardalvarez2390 Oh absolutely. I live in New Zealand, and we all have to pretend about Antarctica, and take turns guarding the ice wall.
@StevenErnest
@StevenErnest 8 дней назад
What scares me is that most of these people can vote. Wonderful video! 🌎
@JohnJones-tx6rt
@JohnJones-tx6rt 9 часов назад
The earth is a disc with 2 large mountains, one on top, one underneath. Space photos prove it.
@coleacanth8944
@coleacanth8944 3 дня назад
If we agree that there is a lie at play, then my question to flatearth is always "why is it important for these decievers to fool the population into believing the Earth is specifically round? Why not any other shape? Or a deity of their choosing??
@johnmaynard869
@johnmaynard869 19 дней назад
“Those who can make you believe absurdities, can make you commit atrocities.” Voltaire
@johnmaynard869
@johnmaynard869 19 дней назад
@@GoldIsSilent0 Games without frontiers.
@AngryGroceries
@AngryGroceries 19 дней назад
funny thing about that... on some level, everything is absurd
@johnmaynard869
@johnmaynard869 19 дней назад
@@AngryGroceries that’s absurd. 😜
@travcollier
@travcollier 19 дней назад
@@AngryGroceries The original quote is longer, more nuanced, and in French.
@justincase4812
@justincase4812 19 дней назад
The US government apparatus, most governments likely.
@BondiAV
@BondiAV 19 дней назад
It looks like you made the leap from "Wrong but Not Stupid" to "Not Just Dumb, but Dangerous". I interacted a few times with flat earthers and learned in the process that they refuse to hear or see anything that does not match their belief. Trying to explain science to one of them is like trying to play chess with a pigeon: no matter what you do, the bird will knock over all the pieces, poop all over the board and walk around with its head held high, as if it won.
@ddegn
@ddegn 19 дней назад
Most the flat earthers I've interacted with behaved in a similar way however every so often there is one who is really willing to learn. For example, one said "if we travel around the sun once a year, then six months later the sun should be in the sky at night." I then explained sidereal and they actually seemed to understand.
@BondiAV
@BondiAV 19 дней назад
@@ddegn I agree that there are exceptions to the "general rule" I described above. Thank you for pointing it out. It is in fact the very reason why, every now and then, I try reasoning with some of them. Didn't lose the hope of finding one who is willing to learn (although I haven't been that lucky yet).
@Mechulus
@Mechulus 19 дней назад
I remembered those previous titles too. The only concern I have is not with 'Flat-Earthers', but with how Sabine is starting to gravitate into the realm of click bait in order to stay relevant / goose the algorithm. There's been a spate of influencers putting out similarly worded click bait lately, which I find intellectually insulting: "Why XXXXX is not just wrong, but DANGEROUS!". Just fill in the thing you dislike with XXXXX and wait for the clicks to roll in - even though there's nothing truly dangerous going on. Is it ignorant to believe the Earth is flat? Yeah. Is it dangerous? Nah.
@odd-arnedahle2173
@odd-arnedahle2173 19 дней назад
@@ddegn And that explanation is just bonkers. Why? Because the Sun can not overhead of everyone at the same line at the same time. Like you can be in Spain and feel the Sun straight overhead, then at the same time, someone in Sweden could have the same feeling of the Sun straight overhead. You would never have that if the Earth was tilted and Sun always ran over the Equator. It is a lie, a bad lie, and the worst part is that you have no clue what I told you.
@MrScrofulous
@MrScrofulous 19 дней назад
Pretty sure you just described #45
@rastanz
@rastanz 11 дней назад
A flat earther told me when the tide goes out it's because the ocean's water is being recycled. Somewhere on flat earth there is a giant water recycling plant.
@PsychoMuffinSDM
@PsychoMuffinSDM 11 дней назад
Tide goes in. Tide goes out. You can’t explain that! /s
@jamesmnguyen
@jamesmnguyen 10 дней назад
As long as my water is clean, I'm ok.....(sarcasm)
@Slartyfartblarst
@Slartyfartblarst 10 дней назад
The land surface also moves, to a much lesser extent. Water is recycled, by the hydrosphere.
@partymantis3421
@partymantis3421 8 дней назад
lol i have yet to hear that one, these flearth models are a riot, the one i hear to explain the sea involves the famed ice wall melting in the summer & reforming in the winter, also theres ofcourse an armada guarding it that the UN protect (man i WiSH we could work that well together on something like that)
@neuvocastezero1838
@neuvocastezero1838 3 дня назад
At least they seem aware of recycling.
@Raptor302
@Raptor302 10 дней назад
I will empty my bank account to any flat earther who can find and view Polaris through their telescope while standing in Australia.
@mkx9095
@mkx9095 8 дней назад
How much you got ?
@Raptor302
@Raptor302 8 дней назад
@@mkx9095 Couple hundred thousand. Do it.
@mkx9095
@mkx9095 8 дней назад
@@Raptor302 I can’t find the moon neither , I asked to know if you was worth an hack 😅
@mkx9095
@mkx9095 8 дней назад
@@Raptor302 I’m joking , don’t worry
@alexg4462
@alexg4462 6 дней назад
@@mkx9095 Ha! I was all ready to fire off a post asking you how you can stand on a continent that doesn't exist. hehe. I used to have a telescope and could find most things relatively easily. It was amazing to see Jupiter with my own eyes, then I bought a refractor and for some reason couldn't find anything. Even the moon took me forever to get a bead on.
@eunomiac
@eunomiac 17 дней назад
The scariest part of this video is the graph showing how much of an impact RU-vid's "algorithm" has on how our civilization thinks.
@getsideways7257
@getsideways7257 17 дней назад
And if that wasn't scary enough, you need to also remember that the favor is shifting towards TikTok these days...
@ASlickNamedPimpback
@ASlickNamedPimpback 16 дней назад
its just google graphs
@volkerengels5298
@volkerengels5298 16 дней назад
The algorithm is aligned with: "'needs' of modern society" It doesn't cause those 'needs'
@mementomori29231
@mementomori29231 16 дней назад
The movie Idiocracy is becoming real
@zyeborm
@zyeborm 15 дней назад
​@@volkerengels5298nah it's aligned with making Google more money, they changed it because they realised they can make more money in the long term if they allow a long term to exist and don't bring about a new dark age.
@passais
@passais 16 дней назад
I think part of the attraction is also being part of a select club and feeling smarter than the "sheeple" because you "figured something out" that others haven't.
@betaorionis2164
@betaorionis2164 16 дней назад
I think this is the main reason to be a flatearther. It's like a drug which (like all drugs) gives you a pleasurable sensation (to be smarter than the rest), but detaches you from the reality (that the Earth is not flat). Also, most flatearthers seem to have had very poor school records and it may have made them resentful against knowledge.
@LoneHorizons
@LoneHorizons 14 дней назад
That’s it exactly. Who wants to be successful and accepted in society if society is all based on a lie? So they become a flerfer and feel superior.
@robvanderwell5695
@robvanderwell5695 13 дней назад
In the same fashion the masses feel superior because they belong to the 'true knowledge incrowd'.
@passais
@passais 13 дней назад
@@robvanderwell5695 no actually, I was convinced when I made my trip to IO.
@ophero108
@ophero108 12 дней назад
@@robvanderwell5695 But they don't though, do they. For the vast, vast, vast majority of people who know the earth is a globe or that 5G isn't mind control or that lizard people don't exist, it's not a big deal. They don't all gather on online forums to discuss the latest in globe-earth evidence - it's a total non-issue that barely ever gets thought about or brought up. The problem that causes flat earthers is the same problem that causes incels and pulls some people into religious cults: it's people with not a whole lot else going on in their life for whom "the earth is secretly flat" fills that void and forms the keystone of their identity. Normal well adjusted folk can weather individual beliefs or traits being scrutinised because it's only a small part of their overall personality. For flat earthers it's all they've got, so they take it much harder and are more likely to double-down and get defensive to protect such a core part of their life. It's why flat earthers need to in many cases be deprogrammed like incels and cult members by supporting them to build confidence in other areas of their life so they can safely tackle the lies they were fed from within the flat earth community.
@Teeb2023
@Teeb2023 11 дней назад
I am fed up qualifying my concern about flat Earthism / science denialism. So often I'm told while combatting their idiocy, "Just ignore it, they're trolls", "Why does it bother you so much?". The rise in anti-intellectualism is both worrying and increasing, more than anyone might be willing to admit. It is a creeping malady that will have a lasting effect on the human race if we do not staunch the haemorrhage sooner rather than later.
@mana3735
@mana3735 10 дней назад
It's led to anti-vaxxers.
@TeaParty1776
@TeaParty1776 10 дней назад
>staunch the haemorrhage remember the alamo
@randus7053
@randus7053 9 дней назад
Not worried about this because the 20th century showed that rapid technological progress isn't inherently good. I think anti-intellectualism stems from the fact that as people get smarter they get more depressed as people realize no individual can change much of anything, so people reject the words of intellectuals and scientists as a way to assert control. After all the old saying is ignorance is bliss. For the most part I see slow change in technology being an opportunity for people to not be left behind. In any case there has always been culture and counter-culture and I don't see anything unique here, just people being irrational as usual. Some minds can be influenced to change some can't, but one can hope that by abiding by truth the world will get better.
@yourfavoritefrog
@yourfavoritefrog 9 дней назад
I understand what you mean and I agree this amount of stupidity is scary . But it is also true that a good amount of them are just trolls, in fact some of them don't really believe in a flat earth to begin with ! They just want to be different , like outrageous teenagers.They want to rock the boat, because it's fun.They want to oppose the mainstream so they feel they exist and they are important, and they want to be heard most of all ! So in the end we don't know how to approach them, do we ? Because arguing , explaining is just pointless. So what is left to us ? Ignore them till this trend passes. Because eventually , it will. Like baggy pants.
@TeaParty1776
@TeaParty1776 9 дней назад
​@@randus7053 Modern intellectuals are nihilist.
@kamino8240
@kamino8240 9 дней назад
Yes, totally agree. When stupidity is more and more accepted and respected, that becomes dangerous
@bitphr3ak
@bitphr3ak 19 дней назад
The first rule of The Dunning-Kruger Club: You don't know you're in The Dunning-Kruger Club!
@Hudoi-1
@Hudoi-1 19 дней назад
At this point anyone trying to find the truth should assume by default they're in the club, even if all evidence points to otherwise.
@bitphr3ak
@bitphr3ak 18 дней назад
@Hudoi-1 humm, you might want to read up on the Dunning-Kruger effect...because it's not as helpful as you might think, as a truth finding flex.
@t16205
@t16205 18 дней назад
@@Hudoi-1 LOL
@Rdlprmpf12
@Rdlprmpf12 18 дней назад
If you don't know whether you're in The Dunning-Kruger Club, you're not in The Dunning-Kruger Club.
@mormatus
@mormatus 18 дней назад
This is hilarious 🤣
@RichardNeill01
@RichardNeill01 19 дней назад
I always assumed that the flat-earth movement was a very extended joke, where one of the rules was "you aren't supposed to admit it".
@acu01136
@acu01136 19 дней назад
I am pretty certain that this is the case.
@herbertshallcross9775
@herbertshallcross9775 19 дней назад
"First Rule of Fight Club" kind of thing.
@brianfox771
@brianfox771 19 дней назад
I think it started off this way, but then it became a situation where you should never underestimate the human capacity for stupidity.
@noumenon6923
@noumenon6923 19 дней назад
That's what I've always thought as well,... just a really committed dry humour.
@815TypeSirius
@815TypeSirius 19 дней назад
First rule of humans: all jokes become real.
@jayeee2756
@jayeee2756 2 дня назад
Very difficult to combat basic stupidity. This is a wonderful analysis of the phenomenon.
@iggi3985
@iggi3985 12 дней назад
Flerfs suffer from Dunning Kruger and confirmation bias. Truly sad state
@MrCheswickMusic
@MrCheswickMusic 7 дней назад
Keep taking those jabs kid
@iggi3985
@iggi3985 7 дней назад
@@MrCheswickMusic it’s funny, because you literally have no argument a part from an assumption that not only is incorrect, but has nothing to do with the topic at hand. I will give you a bit of a history lesson as a freebie. Humanity has known the world was round well before vaccines were invented 😉
@josephbernard5240
@josephbernard5240 Час назад
Don’t forget Occam’s Razor, they jump to a ridiculous conclusion faster than it takes to watch a ship leave port.
@seanemery6019
@seanemery6019 19 дней назад
I met an actual flat earther in 2018 at, of all places, the Grand Canyon. He didn’t even believe in gravity. It was a completely bizarre experience. I was left completely stupefied by the crazy, to be honest.
@subject8332
@subject8332 19 дней назад
You have been Gish Galloped, my friend!
@SabineHossenfelder
@SabineHossenfelder 19 дней назад
I once met a creationist who believed the earth is less than 10000 years old. At first I thought he was joking. Similarly bizarre experience!
@drgetwrekt869
@drgetwrekt869 19 дней назад
and he was floating at the top of the canyon.
@ploppyploppy
@ploppyploppy 19 дней назад
Let me guess - they used the word 'theory' completely in opposite to its actual meaning? If I hear 'gravity is only a theory' suggesting it doesn't exist I just stop all communication and move away. These people have *nothing* to add to the world.
@SoloRenegade
@SoloRenegade 19 дней назад
did you ask him to try jumping across the canyon?
@theronwolf3296
@theronwolf3296 19 дней назад
I got verbally attacked and blocked after asking a FE how it could be midnight in Tokyo and mid day in NY at the same time.
@GusOfTheDorks
@GusOfTheDorks 19 дней назад
I asked someone who believed in the round earth about how we know a vaccine is safe and effective if it hasnt been given the time for proper clinical trials. They started yelling at me that I was trying to kill people. I left after they started telling me I should be put against a wall and shot with a gun.
@rodmehta5356
@rodmehta5356 19 дней назад
Time is fake 😂
@rickinielsen1
@rickinielsen1 19 дней назад
Tokyo is obviously fake! Japanese people are all in on it!
@GusOfTheDorks
@GusOfTheDorks 19 дней назад
Oh fun, looks like they deleted my comment.
@bjornfeuerbacher5514
@bjornfeuerbacher5514 19 дней назад
@@shortgamingmovies2685 How could the sunshine be "local"? If the sun if above NY, why can't its light reach Tokyo?
@larryvanbarriger6670
@larryvanbarriger6670 9 дней назад
I just tell flat earthers that if the earth is flat then why has their life progressively gone down hill? 🤔
@robertsmith262
@robertsmith262 10 дней назад
As long as you understand, the sun would never set on a flat earth, you just can’t believe it’s flat. One and one make two, it is that simple.
@mkx9095
@mkx9095 8 дней назад
Sun is little. It doesn’t set , it goes away on a circle and create darkness in the part that the light doesn’t reach . Didn’t watch the video ?
@robertsmith262
@robertsmith262 8 дней назад
@@mkx9095 don’t know what reality you live in, but the sunsets every day.
@mkx9095
@mkx9095 8 дней назад
@@robertsmith262 it goes away and it looks like going down but it doesn’t
@robertsmith262
@robertsmith262 8 дней назад
@@mkx9095 find a better hobby. Not going to debate with someone who thinks the Earth is flat. Do you know why? Because there is nothing to debate.
@andysmith1996
@andysmith1996 7 дней назад
@@mkx9095 We both know that your explanation makes no sense and you're just here to troll.
@terrancat
@terrancat 14 дней назад
The one flat earther I talked to believed every planet was spherical EXCEPT Earth. I was done. I can't even.
@smeeself
@smeeself 14 дней назад
And you'll never get that time back again...
@saldownik
@saldownik 14 дней назад
It seems like the lady has jus started to discover the truth.
@ThomasKundera
@ThomasKundera 14 дней назад
@@saldownik : That flerfs are dumb?
@spiderprime
@spiderprime 14 дней назад
Some don't even believe there is space and other planets and that we're the only thing to exist.
@ronpapi9539
@ronpapi9539 14 дней назад
@@spiderprime That's me.
@sieglindedeutersbotter1251
@sieglindedeutersbotter1251 14 дней назад
I'm sorry, but the flat Earth being hit a meteor, tilting and thus tossing the dinosaurs into space was just hilarious! 🤣
@gamingcreatesworlddd2425
@gamingcreatesworlddd2425 12 дней назад
😂😂😂😂😂
@whichgodofthousandsmeansno5306
@whichgodofthousandsmeansno5306 11 дней назад
I thought flat earthers don't believe in space even though that's all we see for pretty much infinity.
@lettersquash
@lettersquash 10 дней назад
That's why they evolved into birds.
@StormsparkPegasus
@StormsparkPegasus 10 дней назад
That was actually from a parody video making fun of flat earthers. But yeah.
@mtbrocket
@mtbrocket 11 дней назад
People hate to be told they are wrong; it is humiliating. They will come up with more and more absurd work-arounds to maintain their position is “right” and save face. To change a mind they have to work it out themselves. All we can do is guide.
@Blitterbug
@Blitterbug 16 часов назад
I wouldn't worry too much, Sabine. For the past ten years or so I've been checking in on these oxygen thieves from time to time, but their clown car's either always breaking down or vanishing in a puff of logic. They can't debate without heckling, nor can they follow a Socratic path through a question-and-answer chain of reasoning without crashing with the BSOD.
@mikekilpatrick5686
@mikekilpatrick5686 17 дней назад
Like the saying goes, arguing with a flat earther is like playing chess with a pigeon. it knocks the pieces over, craps on the board, and flies back to its flock to claim victory
@scotttaylor9133
@scotttaylor9133 16 дней назад
Ahh, the unwashed masses, they are so disgusting, aren't they?
@teacherella1338
@teacherella1338 14 дней назад
Sounds like playing chess with Trump 😂
@User-yy6xt
@User-yy6xt 14 дней назад
We don’t argue with people like you.
@ThatBonsaipanda
@ThatBonsaipanda 13 дней назад
One variation that I like goes ".. and strut around like they won the game."
@User-yy6xt
@User-yy6xt 13 дней назад
@@ThatBonsaipanda you people are worthless
@baarni
@baarni 19 дней назад
The big misconception is that flat earthers are honestly trying to figure out whether the earth is flat or not. They are not and will dismiss any evidence that shows anything that contradicts their beliefs…
@yad-thaddag
@yad-thaddag 18 дней назад
Not very different from creationists.
@2bfrank657
@2bfrank657 18 дней назад
This. She pointed out the lack of scientific education, but flat earthers can be explained even more simply than that - confirmation bias.
@Raphael4722
@Raphael4722 18 дней назад
Honestly who cares? By the law of large numbers, you are never going get 100% people to accept something. It's not a lack of education, it's a matter of parts of science being counterintuitive and many people have a limit on how much they are willing to oppose their intuition. Flat Earth is the most extreme case of this. Evolution deniers exist because it's hard to have intuition for something that takes millions of years. Vaccine deniers exist because of the intuition that injecting an unknown substance into your body is dangerous. Viewers of this channel will ridicule all of these. However let's not forget that there is no scientific evidence for free will, while there is plenty evidence for determinism, yet there are most likely people in this comment section who consider themselves "scientifically minded" but cannot go against their intuition when it comes to free will.
@Ben-pd2bx
@Ben-pd2bx 18 дней назад
Right. It's not remotely about what's true. This stuff meets a psychological need. Whether it's flat earth, QAnon, creationism, Scientology, or gender ideology, arriving at the facts is not the point. Such belief systems are not information that "out there" that these people have considered, perceived and understood - they are ideologies that they have adopted and *identified with*, and that's a big difference. The truth doesn't confer an identity. Ideology does. These kinds of beliefs give people membership in a core group of believers who know the Ordained Truth, while everyone outside that group is thought a fool, a sinner, a bigot, an infidel, a sheeple, etcetera. It's tribal and evolutionary. The people I know who go for this stuff are always insecure, and often have very deep traumatic wounds from early life. They want to belong. They want to be special. They want to feel empowered. The want to feel they have an enemy to oppose. They want to define themselves in relation to all these things. To present them with evidence that their claims are false is not to dissuade them. It is to further radicalise them. The reason is two fold: 1. All criticism of their ideas is perceived as an attack on their identity and personhood. 2. All criticism of their ideas is evidence their ideas are correct, because the "sheeple" or whoever, are trying to defeat the truth. The reason to confront these people and their ideas is not to dissuade them, unless you're able to actually involve them in long term deprogramming. The reason to confront these ideas is so that others who are yet to be indoctrinated and may be watching may be spared the same fate. Meanwhile, if you really do want to help someone who has fallen prey to these kinds of ideologies, the only thing that will do it isn't to confront them with facts, but to engage them in relationship. Rarely, this will work. Remember, it's all about identification. If they start identifying with people who believe things that are true, they are likely to change their beliefs. People believe what their tribe believes more often than not.
@jtjames79
@jtjames79 18 дней назад
Flat Earth debunkers will never admit it's just a big troll. Sufficiently advanced incompetence is indistinguishable from malice. It's ridiculous how many people will accept incompetence as an excuse just because it makes them feel smarter for themselves.
@JeremyCaron
@JeremyCaron 3 дня назад
Intentional ignorance will be the death of us all.
@brawdygordii
@brawdygordii 9 дней назад
The one thing I know about Flat Earthers is that they don't WANT to know the truth.
@MrCheswickMusic
@MrCheswickMusic 7 дней назад
Keep taking those jabs kid
@bsadewitz
@bsadewitz 6 дней назад
That's what they "know" about us, lol.
@777dragonborn
@777dragonborn 6 дней назад
Most arrogant truthers there is . They are just as bad as the globalist Pfizer Bill Gates people they talk about themselves. Hypocrites. What they call truth is far from it
@ithinkthonkthunk5333
@ithinkthonkthunk5333 5 дней назад
@@bsadewitzindeed
@nikl.astrophoto
@nikl.astrophoto 14 дней назад
As someone into astrophotography, even we get accused of lying for simply posting images of our hobby. I've been called a CIA asset by some guys on TikTok. Flat earth is like a collective paranoid schizophrenia.
@johnkean6852
@johnkean6852 13 дней назад
ASTROPHOTOGRAPHY: Connecting to Nasa CGI images of space and convincing yourself they're REAL. Keep taking the pills.
@whichgodofthousandsmeansno5306
@whichgodofthousandsmeansno5306 11 дней назад
I am in the satellite radio technologies industry. According to flat earthers I am in on the vast conspiracy to hide the shape literally 99.9999% of people don't care about, or I am also a sheeple being fooled.
@whichgodofthousandsmeansno5306
@whichgodofthousandsmeansno5306 11 дней назад
@lobban2
@lobban2 9 дней назад
What I want to know is why they believe what they believe. What is the point of lying about the shape of the earth?
@mkx9095
@mkx9095 8 дней назад
ru-vid.com/video/%D0%B2%D0%B8%D0%B4%D0%B5%D0%BE-qEaHjPF47_E.htmlsi=CkC3Hh1CvfdJm9z1
@Scinquisitor
@Scinquisitor 17 дней назад
I really recommend the documentary called "behind the curve" about flat-earthers. The funniest moment is when a flat-earth blogger rants about her collegues, who claim she is part of a conspiracy to discredit the flat-earth movement. She talks about how it's unfair when people claim that you are part of conspiracy when you are not, and when they make things up about you. Then for a moment she considers "what if all those scientists I accuse of conspiracy feel the same way"... just then to add "but those guys are in fact conspirators!"
@User-yy6xt
@User-yy6xt 17 дней назад
It’s made by people who’s goal is to make you think it’s too stoppid to look at and you fell for it.
@johnqpublic7608
@johnqpublic7608 17 дней назад
@@User-yy6xt because it's stupid.
@mynamemylastname7179
@mynamemylastname7179 17 дней назад
You should watch "the martian" documetry when Nasa sent matt damon to grow potatoes on mars back in 2015. Much better then that Apollo 11 💩 from 1969 😂😂😂😂😂😂😂😂😂😂
@User-yy6xt
@User-yy6xt 17 дней назад
@@johnqpublic7608 Yeah it was. It was totally stupid. It had not one thing that was true about the flat earth or flat earthers in there. It was made up garbage designed to keep you all ignorant to what people who see the flat earth see and where they look to see it. They won’t v show you what we see because then you would see it too.
@Matuse
@Matuse 17 дней назад
@@User-yy6xt By all means, dazzle us with how smart you are. Prove anything about flat earth.
@FirebrandVOCALS
@FirebrandVOCALS 3 дня назад
Flat Earthers are the real life Truman Show cast
@foreverpinkf.7603
@foreverpinkf.7603 12 дней назад
As the great German philosopher Erwin Pelzig said: there have always been idiots, but they have known about each other since the internet came into existence. They grow and thrive on social media. P.S. love your channel; never give up, never surrender!
@SomeMorganSomewhere
@SomeMorganSomewhere 17 дней назад
The irony is that I've some vague recollection that Flat Earth Society was originally created by people who weren't ACTUALLY flat-earthers, it was more like the Society for Creative Anachronism, little did they know they'd get overtaken by the actual flat-earthers...
@worsethanhitlerpt.2539
@worsethanhitlerpt.2539 16 дней назад
People who just like to argue for no reason like teenagers and Woke college students
@jal051
@jal051 15 дней назад
Yeah. The first video Sabine made was about that. She, in fact, defended the cynical aspect of the original flat Earth movement.
@Justwantahover
@Justwantahover 14 дней назад
There are a fair few poes, who just pose as flerths, for money and "fame". If any flerth who shows any hint of intelligence, most probably aren't flat earthers. And the dummies (who are genuine flerths) just follow. The poes might write a book called "Flat Earth for Dunmies". 😅
@User-yy6xt
@User-yy6xt 13 дней назад
Other way around DA
@johnkean6852
@johnkean6852 13 дней назад
The flat earth society is unrepresentative of modern flat earth theory
@UnMoored_
@UnMoored_ 19 дней назад
These people are not essentially crazy, but they were left behind during the critical mental development during childhood which left their ability to reason and conceptionally represent reality with sufficient fidelity as to participate constructively within society. This creates a profound sense of incompetency and compromised social identity which motivates them to join groups which are susceptible to harmful conspiracy theories.
@duanecarroll8255
@duanecarroll8255 19 дней назад
Otherwise known as HOME SCHOOLED!
@Nefville
@Nefville 19 дней назад
While I assume I would agree with the intent of what you are attempting to say, I'll take ranch on my word salad.
@juimymary9951
@juimymary9951 19 дней назад
@@duanecarroll8255 Well...considering what the public school system is like in places such as the US...
@eh1702
@eh1702 19 дней назад
There is some research to show that people who believe a lot of conspiracy theories are more fearful than general. And also not generally of high educational attainment. The feeling of being bewildered by a fast changing world, by social and technological change, being clobbered by scary phenomena that seem to come out of nowhere (like economic recession) - all of this resolves once you are “in” on the secret of the lizard people or whatever. It is a more inchoate, ad hoc way of dealing with Big-Scary-Hard-To-Get-A-Grip Reality than the more conscious religious injunction to accept the will of God whether or not you understand it. It has the comforting advantage of feeling like you do understand it. Plus it gives you the fantastic feeling of at last being smart- smarter than the smart kids you went to high-school with.
@jflaplaylistchannelunoffic3951
@jflaplaylistchannelunoffic3951 19 дней назад
@@duanecarroll8255 I would argue that home schoolers are less prone to become flat earthers, since during home schooling one has far more opportunity to think things through.
@AusSkiller
@AusSkiller 11 дней назад
I cannot understand flat earthers. I see evidence of a globe earth every time I look out my window. Simulations of a globe that I program on my computer look just like what I see in reality, whereas simulations of a flat earth look quite different. And while the globe earth model has highly accurate maps and calculations to reasonably accurately predict what will happen, flat earthers don't even have a map that that can acurately tell me how far it is to a nearby city let alone be able to predict anything. I cannot understand how any reasonable person could believe the earth is flat.
@alainbellemare2168
@alainbellemare2168 10 дней назад
How many flat earthers does it take to change a light bulb in the southern hemisphere .
@exokitten
@exokitten 19 дней назад
I tried my best to debate a flat earther while remaining respectful. I was unsuccessful at swaying him, but here are my best, easy to digest arguments that anyone facing the same type of situation can use: • Ships and airlines use globe coordinates to navigate. Ask a pilot or a captain and they will confirm. • If the Earth were flat you would be able to see all mountain ranges with a telescope. • Light cannot shine down in an isolated location without being visible to all those on the same plane beneath it. The flat earth map does not align with how light functions. • If we were all on a flat surface we would all see the same constellations.
@brucetucker4847
@brucetucker4847 19 дней назад
The Sun has a lampshade. A lampshade that changes shape with the seasons. Didn't you know? (RIP Sci Strike, you are missed but never forgotten)
@mcv2178
@mcv2178 19 дней назад
I like your mountain range example.
@BOO-ii3ni
@BOO-ii3ni 19 дней назад
You are dumber than him for trying to debate about physics with someone that never tried to learn physics.
@goodfortunetoyou
@goodfortunetoyou 18 дней назад
Looks somewhat fun. 1. Using spherical coordinates does not in and of itself imply the earth is a sphere. Indeed, I believe that they can be mapped into the euclidean coordinate system. 2. There can be fog, and objects obstructing your view. Additionally, there could be an effective render distance. 3. If light is emitted as if from a flashlight, the light illuminates a cone between the source and the plane. Now, you might argue that the sun is a sphere, and is a point source. However, all we can observe is the 2D dome of the sky, where it presents as a disk. 4. The world loads in semi-continuous chunks, where each star can be seen a a puncture of the sky-dome (let's call it the firmament or something) and is only visible from chunks illuminated by the star's light cone.
@livestock9722
@livestock9722 18 дней назад
1 minute of latitude/longitude equals 1 nautical mile (slightly off in Northerly/Southerly airspace due to... well duh?). Pretty handy on aeronautical maps when trying to find coordinates. This would absolutely not work in a flat earth universe.
@SinclairA
@SinclairA 19 дней назад
"They are more confident than the average person ..." that's Dunning-Kruger for you there.
@catcatcatcatcatcatcatcatcatca
@catcatcatcatcatcatcatcatcatca 19 дней назад
It’s not Dunning-Kruger. The effect is often misrepresented. In the study, the people with little knowledge still correctly identified they had less knowledge then the experts, they just wastly underestimated the information gap, as they weren’t even aware of much of the knowledge the experts knew. The experts in turn overestimated the knowledge the average people had. It’s not that they doubted themselves or weren’t aware of their position as an expert. Flat earthers aren’t just more confident in their knowledge, they flat out think the experts are wrong or lying. They aren’t just unaware of the knowledge gap, but believe its just filled with lies and deception.
@HolyMith
@HolyMith 19 дней назад
​@@catcatcatcatcatcatcatcatcatcathank you for clarifying that for me, I wasn't aware that was the study that was actually done.
@DarkShroom
@DarkShroom 19 дней назад
@@catcatcatcatcatcatcatcatcatca "The experts in turn overestimated the knowledge the average people had" -i don't think you have any evidence of that claim otherwie you would have probabally said it, in my experience they are confident in their own reasoning and think the experts are duped, if this is because they are unable to grasp basic science, as most of us judge, then it's technically the Dunning-Kruger effect just i guess i'm tired of people using it when arguing with one another, which is maybe why Sabine didn't mention it
@bspiken
@bspiken 8 дней назад
The sympathy is what I struggle with. Im actually pretty convinced that they are not interested in discovering how the world works, they are interested in the conspiracy, on proving other people wrong. Their motivation seem to be grievance rather than curiosity.
@mcdinkysgarage4514
@mcdinkysgarage4514 День назад
Half of the yin-yang is black. Half of people are liars. Only half of people want the world to improve. Notice and adapt.
@keithdaniels5918
@keithdaniels5918 10 дней назад
Still waiting for pics from the edge.
@b.chuchlucious5471
@b.chuchlucious5471 6 дней назад
You can try to go to the edge but the military will stop you. The governments know, but will keep you in the dark. 60° latitude is your limit.
@demidron.
@demidron. 19 дней назад
Every time I asked them why I, in the southern hemisphere, see the stars revolve clockwise around a point in the sky directly south of me, whereas they, in the northern hemisphere, see them revolve anticlockwise around a point in the sky directly north of them, they disappear.
@hodgeyhodge8414
@hodgeyhodge8414 19 дней назад
Have you actually stared at the sky long enough to independently verify that that's what they do? The sky moves very slowly. I have watched the moon crawl across the sky, but never the sun or the stars. In any case, I think you'd be hard-pressed to find a flat-earther who has travelled to both hemispheres of the earth...
@dynamicflashy
@dynamicflashy 19 дней назад
@@hodgeyhodge8414 Turn on a camera to record the sky, and then watch it back sped up.
@noway905
@noway905 19 дней назад
I live in the northern hemisphere and have watched the stars at night for over 60 years and can attest that they rotate clockwise around a fixed point called the north star. The big dipper proves the stars do not "disappear."
@w01dnick
@w01dnick 19 дней назад
​​@@hodgeyhodge8414it's not that slow, actually Moon, Sun and stars rotate at almost the same speed, because it's mostly Earth rotation. As for seeing that, you don't even need a telescope. Just remember where stars are at midnight and check hour later. They'll move for about 15°, or 30 Moon's diameter, that is pretty noticeable. With telescope that rotation is a PITA, because you have constantly adjust direction to see planets, stars. P.S. 30 diameters - that is near sky equator, closer to the Polar star lesser is difference, but it's still noticeable a lot.
@Polit_Burro
@Polit_Burro 19 дней назад
There is no "southern hemisphere".
@itchyomalley
@itchyomalley 17 дней назад
You can't reason someone out of something they didn't reason themselves into. My brother's a flat earther (among other things) He's been dismissed by his family and friends for so long, he seeks out like minded individuals and lives among them now.
@mkx9095
@mkx9095 8 дней назад
ru-vid.com/video/%D0%B2%D0%B8%D0%B4%D0%B5%D0%BE-qEaHjPF47_E.htmlsi=CkC3Hh1CvfdJm9z1
@shada0
@shada0 2 дня назад
I would like to point out that I'm not running into a lot of Flat Earthers online, just people laughing at them.
@kentjenkins734
@kentjenkins734 9 дней назад
I was surprised to find out that they don't understand what a vacuum is. They (or at least many of them ) think that a vacuum is a force in its self, rather than the mere absence of a force. Many of them think that this force causes objects to move away from one another, tearing apart anything with air inside it.
@rocketscience4516
@rocketscience4516 19 дней назад
Funny how they trust in science when they go out to buy a mobile phone, or pay for internet access. Or buy a TV. Or... (list goes on and on).
@Thomas-gk42
@Thomas-gk42 19 дней назад
Absolutely right!
@daniellove162
@daniellove162 19 дней назад
Sometimes people will cry “TRUST IN SCIENCE” in lieu of saying “DON’T QUESTION OUR NARRATIVE”. Scientists throughout history have questioned currently held science to refine science. Also, for years people thought Newtonian physics was the final destination and the some dared to do science and discovered it was merely the surface.
@juimymary9951
@juimymary9951 19 дней назад
I think it's mostly that they ignore that all branches of science are interconnected to some extent To them the shape of the planet and the function of an electronic device aren't related and therefore to them there is not even the cognitive dissonance.
@Bill_Bo
@Bill_Bo 19 дней назад
What they do is separate science from technology and pretend they have nothing to do with each other in order to avoid the inevitable cognitive dissonance.
@drgetwrekt869
@drgetwrekt869 19 дней назад
its because they dont understand how these things work (well like 99.99% of people actually).
@mikotagayuna8494
@mikotagayuna8494 19 дней назад
Flat earth prophets know exactly what they are doing. It's not important whether or not they actually believe what they're preaching but it is very important for them that people continue buying their books, going to their conferences and subscribing to their platforms. When confronted, they will double down and claim conspiracy because attacking their beliefs threatens their livelihood, and thus, their perceived right to live comfortably.
@mobilephil244
@mobilephil244 19 дней назад
It goes way deeper than just their living. Psychologically, conspiracy theories come from the same place as religious fanaticism
@devthis5135
@devthis5135 19 дней назад
It's so true, and at the same time, so sad...
@thstroyur
@thstroyur 19 дней назад
"it is very important for them that people continue buying their books, going to their conferences and subscribing to their platforms" Meaning that, in order to be a Flat-Earther, one is obliged to do all those things?
@rclaws3230
@rclaws3230 19 дней назад
The commies want their perceived right to live comfortably upheld by everyone else's tax dollars; at least these fools are making people laugh while peddling their nonsense.
@ary2766
@ary2766 19 дней назад
​@@thstroyur the more you preach an idea, the more you increase the likelihood of finding someone who accepts it. Not all flat earthers will support the preachers but even if 5% of the supporters do the bare minimum of visiting their dumb seminars, or buying their books for whatever reason, (it most likely stems from a need to socialize and actually interact with someone on their level as most of society is clearly way too intellectually superior compared to them) will make them a fortune
@waskus
@waskus 5 дней назад
When I try to have a diskussion with flat earthers, none of them can explain it to me. They all type: do your researche😂😂😂
@thaddeuslangley6519
@thaddeuslangley6519 10 дней назад
Theres a documentary called 'behind the curve' that does a great job expounding on the points made in this video. And its free on tubi.
@hor80
@hor80 10 дней назад
Interesting!
@zilfondel
@zilfondel 3 дня назад
Oh its funny
@runeskogstad6927
@runeskogstad6927 2 дня назад
I´ve seen "behind the curve". And I am surprised how stupid people really show off how dumb they are. But of course they are all from the US, where religion is destroying young persons ability to accept fact. I never studied in the US, but there must be a very poor educational system. What worries me, is that they also can vote.... The "star" in this movie I Mark Sargent. He is making a lot of money of this stupidity, so that's fine for him. To get rich from other "believers" stupidity.
@MrEW1985
@MrEW1985 19 дней назад
I just had the biggest laugh when the Flat Earth society claimed that it had members all around the globe.
@gsmollin2
@gsmollin2 19 дней назад
Really? Now THAT is irony!
@richardalvarez2390
@richardalvarez2390 19 дней назад
Flat earth Society is controlled opposition. Flat earthers do not take that statement seriously. As being around the world is bogus
@acmhfmggru
@acmhfmggru 19 дней назад
Flat Earth Society is very tongue in cheek. The entire idea is tongue in cheek, though there are also really low IQ people who don't realize that and take it completely seriously, to be fair, but the leadership is really very clear about FES being about skepticism and the scientific method (a point that is ironically lost on Sabine, who doesn't even mention the FES, just the vague idea that people think Earth is genuinely flat). It is a statement against blindly believing authorities and demanding evidence and clear explanations: any person can see that the surface of the Earth appears to be flat at a human scale, and the overwhelming vast majority of people do not have any natural experience that proves to them that the Earth is a globe. It isn't that there's some supposed big conspiracy, it is that they are skeptical and advocating skepticism. Or you can just jump on the bandwagon and say "hahaha those people are sooooooo dyum!! I'm glad I'm not those people!!!".
@richardalvarez2390
@richardalvarez2390 19 дней назад
Let's not forget, there is a 3 hour testimony of pilots and pilot instructors admitting the earth is flat, on RU-vid
@wiredforstereo
@wiredforstereo 18 дней назад
So effing cliche.
@willbrink
@willbrink 19 дней назад
Flat earthers make moon landing deniers look like geniuses...
@quietschbaer
@quietschbaer 5 дней назад
What moon? There is only a hole in God's heavenly blanket!
@randallboone9375
@randallboone9375 2 дня назад
Every time I hear flat earthers talk, it reminds me of that zoolander movie
@user-ls1qc8hg2s
@user-ls1qc8hg2s 10 дней назад
I think this quote sums up flat earthers nicely. “You know, the very powerful and the very stupid have one thing in common. They don’t alter their views to fit the facts. They alter the facts to fit their views.” - The Face of Evil: Part Four (1977)
@nosferatu5500
@nosferatu5500 19 дней назад
i think logic classes should be mandatory in school. Its fundamental for all subjects, mathematical formalism and later in life.
@drgetwrekt869
@drgetwrekt869 19 дней назад
school and all is mandatory since 200 years or so (even more). its not about schools. the problem is society as a whole.
@SoloRenegade
@SoloRenegade 19 дней назад
Philosophy classes. The basis of all science and the rules of debate are taught in Philosophy. There is a reason PhD is the most widely know Doctoral degree (PhD = Doctorate of Philosophy).
@edene.4870
@edene.4870 19 дней назад
It *is* mandatory. Logic and critical thinking are an essential part of classes like maths, physics, chemistry, history, and most importantly literature analysis. And these classes are all pretty much core classes in most civilised countries. If you take a look, most flat earthers are either US Americans or people who are from another country but have had little education and a lot of exposure to US centric media and social media. And an even closer look will reveal that these US Americans are from states where education has been whittled down and outright butchered. This is not a coincidence.
@juimymary9951
@juimymary9951 19 дней назад
Absolutely
@joansparky4439
@joansparky4439 19 дней назад
not even basic economics is based on logic.. which is why flat earthers have become a phenomenon in the first place.
@tombutler4726
@tombutler4726 19 дней назад
I think it's a combination of willful ignorance for some and simple trolling for others.
@GusOfTheDorks
@GusOfTheDorks 19 дней назад
They just dont trust people that have a track record of lying to them for fun and profit.
@karlchilders8215
@karlchilders8215 19 дней назад
A lot of it is willful ignorance but the vast majority of flerfs are too stupid to understand basic science. It's beyond their capacity. I have tried and tried to understand how an automatic transmission works but I just can't get it. I would like to know about quantum mechanics but when I read anything about it I literally get a headache. People have limitations.
@BeyondAldebaran
@BeyondAldebaran 19 дней назад
@@GusOfTheDorksThis is why I am sympathetic to flat earthers. They are like old hippies believing in crystals. Hilariously wrong, often politically charged, but not bad people. PS-also don’t worry so much, humanity was doomed from star. just have fun. If space colonization works and man survives, then what a great surprise!
@joesterling4299
@joesterling4299 19 дней назад
Yes! That would be a worthwhile investigation. How many of these miscreants are in it just for the trolling, and how many actually believe.
@Ryan-ff2db
@Ryan-ff2db 19 дней назад
I found most flat earthers are argumentative in nature and not just about flat earth, about all things. They just like to argue and they are usually men.
@wallykramer7566
@wallykramer7566 День назад
When I was in fourth or fifth grade, there was this kid who had determined the moon landing was fake. His evidence? The photos they took on the moon were _too_ _clear_ ! I'll bet he is now in the Flat Earth Society or whatever it is called. He constructed his belief system rather impressively so as to make it self consistent. But casual reflection should have revealed how much effort he put into his world view which was way more effort than simply accepting the scientific viewpoint and probably bending his mind to figure it all out.
@yoursoulisforever
@yoursoulisforever 12 дней назад
I live in rural Kansas USA and it is FLAT AS A PANCAKE but I have never in all my 67 years traveling all around this State meet anyone that thinks the earth is flat. Oh well, at least I'm curious now to find out what this is about so...on with the video!
@TylerAult
@TylerAult 19 дней назад
"They're trying to figure out how nature works" (6:27) -- No, they're not. I know this is a segway to the ad but this is the whole problem. Flat Earthers begin with a conclusion and then try to justify it, much like religious people. They aren't interested in observation except to selectively prop up their pre-existing assertion.
@MarcPagan
@MarcPagan 19 дней назад
Leftists, Democratic Party voters in the USA, are on par with Flat Earthers ......for their impressive immunity to facts, science, and reality.
@michaelsommers2356
@michaelsommers2356 19 дней назад
A segway is a scooter. A segue, pronounced the same way, as two syllables, is a transition.
@rahantr1
@rahantr1 19 дней назад
Oh come on, cut them some slack. Every scientific field has some p-hacking issues.
@deathsinger1192
@deathsinger1192 19 дней назад
except, religious people don't necessarily ignore proof, you cannot proof that god doesn't exist, that doesn't proof his existence either, but you can disprove flat earth quite easily
@xintophotography9848
@xintophotography9848 19 дней назад
@@deathsinger1192religious people believe nonsense proofs and nonsense logic are actually proofs based on actual logic. Also, most atheists have concluded that religions are dumb and/or that gods are incoherent nonsense. It is rare for them to argue that gods are provably nonexistent (and indeed, religious cosmologies are so ill defined that it isn’t clear what is supposed to be disproven).
@BoBoZoBo
@BoBoZoBo 15 дней назад
I have a private pilot and space enthusiast and my father-in-law in Iowa talk about aviation and space all the time for the first 10 years of our relationship. One day he got a new smartphone and I introduced him to RU-vid. Told him I had really good videos on space flight and aviation. 6 months later he became a complete flat earther. True fucking story. One day I had asked him if he had seen the SpaceX launch and then he told me it was bulshit it took me a good full hour to realize that he wasn't joking around with me and that he had seriously changed his mind about everything. Thank you internet.
@raypeery6317
@raypeery6317 14 дней назад
Cool story bro. Variation 11,075 on the same story. Globetards have no imagination, just parrots and sheep.
@ronpapi9539
@ronpapi9539 14 дней назад
All retired Pilots come forward with FE Truth, so as not to lose their retirement benefits by exposing the Lie of a Globe
@parody_bear_mike
@parody_bear_mike 14 дней назад
Bruce McCandless made history performing a spacewalk during STS-41B with no lifelines Bruce's rotation 1,000 mph Bruce's orbit around the sun 66,600 mph Sun's orbit around the galaxy 514,000 mph Galaxy traveing thru space 3,600,000 mph not felling any of it Priceless? or MindLess!!
@grahvis
@grahvis 13 дней назад
@@parody_bear_mike . The human body has no mechanism for detecting constant, steady movement, only a change in speed or direction over a certain amount.
@distortionhead37
@distortionhead37 13 дней назад
Much ouff!
@ray_notes8170
@ray_notes8170 10 дней назад
The big tell the flat Earth is false, is that nobody from their rather sizable community has ever created a functional map or model. This, despite the fact humans navigate the Earth every day with extreme precision.
@ChewyChicken589
@ChewyChicken589 10 дней назад
Vibes of Cosmos has
@hor80
@hor80 10 дней назад
Exactly, no one could ever present a concept for FE that would work with everything we see and experience every day/every year.
@ray_notes8170
@ray_notes8170 10 дней назад
@@ChewyChicken589 any links to that content?
@davidmescher2526
@davidmescher2526 10 дней назад
​@@ChewyChicken589Looking at the links provided by the Google search vibes of cosmos flat Earth map, it's a bunch of bunk.
@smeeself
@smeeself 10 дней назад
​@@ChewyChicken589No, they haven't
10 дней назад
That is because the vast majority of flat land believers are from the northern hemisphere. With a journey (or a zoom connection) to a point in the southern hemisphere, it would be worth to realize that the stars do not revolve around the north pole.
@smeeself
@smeeself 10 дней назад
It absolutely boggles me how an occasional Australian flat earther pops up. Do they NEVER go outside?
@JohnSmith-ux3tt
@JohnSmith-ux3tt 9 дней назад
The problem has been pointed out many times, but the flat earthers just can't seem to get it. I put it down to stupidity - the don't have the processing power to visualize the issue.
@magilviamax8346
@magilviamax8346 20 дней назад
I was under the impression that flat earthers were just a bunch of people in search of attention, cause none should be that incompetent. But if Sabine feels the need to talk about it, it really must be worrisome. My faith in humanity is dwindling.
@SabineHossenfelder
@SabineHossenfelder 19 дней назад
I guess you are right that search for attention is part of it for the people who you see on social media. But there's a larger group of quiet people behind them, the ones who share, lurk, and like. It's also really hard to make headlines with flat earth theories. I think that the attention-seekers are more of the sort who come up with a proof of the Riemann hypothesis or a theory of everything etc, something that plausibly would be front page news.
@marcinnawrocki1437
@marcinnawrocki1437 19 дней назад
Nah arguing about silly stuff on FE forums is amusment.
@sababaratashvili8629
@sababaratashvili8629 19 дней назад
@@SabineHossenfelder You underestimate amount of attention seekers. It is combination of attention seekers, stupid people and people who just do it for fun. I worry much more about politics and activism in science, which only feeds such "sceptics".
@pablov.viteri9345
@pablov.viteri9345 19 дней назад
@@SabineHossenfelder Follow the money who founded
@donm5354
@donm5354 19 дней назад
Sometimes I go on Flat Earth Society forums just to mess with heads of people literally angry that people CLAIM the Earth is FLAT.
@ernestuz
@ernestuz 19 дней назад
I met a flat earther in Texas 5 or so years ago. The guy was an engineer, at the beginning I thought he was just joking, but nope, he was genuine. At the end everything came down to his religious beliefs.
@GuardianSoulkeeper
@GuardianSoulkeeper 18 дней назад
_"Religion Poisons Everything"_
@johnhough7738
@johnhough7738 18 дней назад
If his religion involved engineering, and if his engineering involved religion; just so long as none of his bridges or buildings fell/fall down, no problem. But if he cast aside practical safety considerations and just prayed to The Lord for those to be covered; I think he should be promoted to ex-engineer. Perhaps he compartmentalised? A lot of them do, and some are brilliant at it. (And now to look up 'cognitive dissonance' again ...)
@gibfear
@gibfear 18 дней назад
He "said" he was an engineer you mean? 🤣
@johnjeffreys6440
@johnjeffreys6440 18 дней назад
Flat earth is not biblical.
@pvanukoff
@pvanukoff 18 дней назад
I've known at least one educated, professionally productive flat earther. It's weird.
@danielroncaioli6882
@danielroncaioli6882 9 дней назад
If the earth was flat, cats would have knocked everything over the edge by now.
@chrisgorman1652
@chrisgorman1652 5 дней назад
No - haven't you heard that the NASA agents have been in Antarctica for over 100 years to stop things like that😂
@georgesimon1760
@georgesimon1760 3 дня назад
In the US I'm too busy worrying about Christian nationalists and other conspiracy theorists to worry about flat earthers.
@smeeself
@smeeself 3 дня назад
That Ven diagram has a lot of overlap.
@georgesimon1760
@georgesimon1760 3 дня назад
@@smeeself yea it does. So far flat earthers aren't telling others to live their lives as if the earth is flat though.
@brothergrimm9656
@brothergrimm9656 19 дней назад
The information age has revealed one thing, nothing travels faster than light except ignorance and conspiracy theories on the internet.
@tvviewer4500
@tvviewer4500 19 дней назад
How many covid boosters do you have in your arm, slick?
@yeroca
@yeroca 19 дней назад
obviously wrong, but also correct for comedic purposes
@Rhomes7
@Rhomes7 18 дней назад
Truth. Even the universal speed limit bends the knee for Dunning-Krueger.
@Raphael4722
@Raphael4722 18 дней назад
I'm tired of people complaining about the internet. There were probably even more uneducated people with ridiculous beliefs BEFORE the internet. You just didn't know about it because they would only talk to their friends and family about it.
@tvviewer4500
@tvviewer4500 18 дней назад
@@Rhomes7 how many Covid boosters do you have in your arm, smart guy?
@wonderpope
@wonderpope 19 дней назад
My main problem with flat earthers is that they give a bad name to skeptical people in general. The push by authorities to censor social media because of "misinformation"/"desinformation"/"malinformation" is getting stronger. This starts silencing anyone who might have good reasons to counter official narratives, because you are put in the same basket as flat earhters.
@decafjava8565
@decafjava8565 19 дней назад
Very true.
@alchobum
@alchobum 19 дней назад
The censorus work hard to create that link. Only a flat earther conspiracy theorist would even dare say higher taxes and not being allowed to drive on weekends are bad.
@xintophotography9848
@xintophotography9848 19 дней назад
Conspiracy theories in general have so stretched the concept of skepticism that it no longer means anything. Science should invent some new word to represent healthy and informed skepticism.
@user-uc2qy1ff2z
@user-uc2qy1ff2z 19 дней назад
@@xintophotography9848 As if worldwide bullexcretes is sanely explainable without conspiracy theories. However, conspiracy theories could have different quality.
@emildavidsen1404
@emildavidsen1404 19 дней назад
Im gonna second what another has already commented, flerfs are "just" one of the many conspiracy theories which has flurished over the last couple of decades. We humans have some catching up to do regarding our social and cognative abilities if we are to keep pace with our information tech. Using history as a guide, I'd say there is a decent chance/risk that many wars will need to happen before we take this seriusly enough.
@ArhjuahSavonovich
@ArhjuahSavonovich 12 дней назад
It's all "Trust me bro", because '"doing your own research" you'll discover that the creator of the modern flat earth was a 9yr old dropout. And "critical thinking" concludes, the dude couldn't even make it passed the 2nd grade. Ask yourself, - Who are the sources of information ("leaders")? - What have they achieved to deserve any merit? - What have they done to demonstrate they have any understanding of the subject?
@mrl4859
@mrl4859 12 дней назад
"you'll discover that the creator of the modern flat earth was a 9yr old dropout" For flat earthers, this is seen as an advantage. It means they haven't let themselves be brainwashed by indoctrination.
@ArhjuahSavonovich
@ArhjuahSavonovich 12 дней назад
Cool story, bro.
@groaningmole4338
@groaningmole4338 19 дней назад
They dismiss anything that they can't understand in 10 seconds as being a lie. Nothing can be done about this.
@johnjeffreys6440
@johnjeffreys6440 18 дней назад
I was often the first person to make a comment on Eric Dubay's channel, but he or any other viewer ever replied to my comment, which leads me to believe that most of them didn't believe it either. I would say, if the earth is a disc, then all the bodies of water would be still like a pond, but the oceans are always churning because water can't settle ion a spherical surface.
@DieterDuplak314
@DieterDuplak314 18 дней назад
revoke voting rights?
@marksea64
@marksea64 18 дней назад
@@johnjeffreys6440 Spherical has nothing to do with it. Water could perfectly well settle on a spherical surface if the sun weren't mixing up the oceans and the atmosphere.
@johnjeffreys6440
@johnjeffreys6440 18 дней назад
@@marksea64 the moon has more to do with the tides and the waves of the ocean than the sun.
@marksea64
@marksea64 18 дней назад
@@johnjeffreys6440 I wasn't referring to the tides, but yes, the moon has a stronger effect on tides. The point stands.
@mr.bisley2748
@mr.bisley2748 17 дней назад
Right now, flat earthers are at the very bottom of my list of worries.
@AxelPixel-cx4wg
@AxelPixel-cx4wg 17 дней назад
Flat earthers ARE the very bottom!
@user-os4lj3pi4q
@user-os4lj3pi4q 17 дней назад
they shouldn't be so low. It's like having something funny in your skin (maybe cancer) and ignoring it because it doesn't hurt in any way (YET).
@NeroDefogger
@NeroDefogger 17 дней назад
and am I?
@vir00
@vir00 16 дней назад
​@@user-os4lj3pi4q As a subgroup flat earthers are totally harmless like the crystal wearing horoscope trusting other interpretations of observable reality out there. They are the distrustful inverse of the part of population that went positively militant with trust the science without critical thinking or understanding how it actually works or what could go horribly wrong. A good part of humanity is just following groupthink and *that* is the real danger here.
@Frenchy78ify
@Frenchy78ify 16 дней назад
@@user-os4lj3pi4q yeah ? why do you care so much ? we have proof but yall cry everytime we bring them lmao boohoo nasa didnt lie to me all my life, hundreds of times
@Greenmarty
@Greenmarty 7 дней назад
Scary is that similar intellectual decline did happen multiple times in history and was followed by dark age kind of periods.
@benlynch7249
@benlynch7249 6 дней назад
how does their phone work, also, how does starlink work, which we can all see?
@smeeself
@smeeself 6 дней назад
You don't need to get technical with them. They can't even comprehend a sunset.
@scollyb
@scollyb 19 дней назад
The thing that really amazes me is that the rise in cheap drones hasn't killed flat earth. You literally have a machine where you can move the horizon back and forth at will
@osmosisjones4912
@osmosisjones4912 19 дней назад
You can test curvature of the ground why towers get shorter before They get smaller Tower . Traffic lights behind other traffic lights are visible
@M_SC
@M_SC 19 дней назад
You don’t understand psychology, which I don’t mean as an insult. It’s not about physical facts. It’s about emotions
@Llortnerof
@Llortnerof 19 дней назад
These people will literally refuse to accept reality if it doesn't fit their preconceived notions. Not that reality gives a damn either way.
@thorwaldjohanson2526
@thorwaldjohanson2526 19 дней назад
It's usually people who believe in other conspiracies, have distrust of the government and anything they don't understand. Being part of a group and having an external reason why things are bad can be comforting to people.
@matthewedwards9423
@matthewedwards9423 19 дней назад
Drones are in on it.
@taWay21
@taWay21 19 дней назад
The scariest thing is there seems to be a growing reality gulf between folks with common sense and critical thinking skills, and folks who just consume everything they see on their phone screen.
@YellowKing1986
@YellowKing1986 19 дней назад
The population of flat earthers is utterly insignificant. It's like a certain group of people who think they are not who they've been born as. Its a tiny fraction of people and yet we are expected to accomodate it and have the one correct opinion on it. Personally I don't think they matter that much. Let people be wrong. The only reason you know they exist is because it's a click inducing topic. So dumb you just cant help but be fascinated by it. In reality its just a drop in a bucket.
@declandougan7243
@declandougan7243 19 дней назад
@@YellowKing1986We are not expected to accomodate flat earthers. They are flat out wrong. We should be expected to accommodate transgender individuals, because that’s not about belief it’s about survival and wellbeing.
@GusOfTheDorks
@GusOfTheDorks 19 дней назад
You know, maybe saying this would mean something if we didnt just spend multiple years of scientists and the public regurgitating whatever their phones and TV screens said about covid.
@YellowKing1986
@YellowKing1986 19 дней назад
@@declandougan7243 But we are expected to accomodate other cultist believers, like transhumanist ideas. It's interesting about why is that the case with some, and not with others. Why is it that so many people who aren't part of their weird niche community are thinking about, talking about and making videos and consuming videos about it? It's a curiosity. It's weird adn bizzare thing you notice because it stands out. It doesn't tell you anything interesting about people as whole. Other than that some people are just into some weirdness. And it has no impact on your life, if you don't let it happen.
@YellowKing1986
@YellowKing1986 19 дней назад
@@GusOfTheDorks Exactly, the term "conspiracy theory" or "misinformation" lacks any substance. It's not saying anything about the quality or validity of information.
@whichgodofthousandsmeansno5306
@whichgodofthousandsmeansno5306 11 дней назад
The problem is things like cameras and telescopes don't work on Flatardia. And things like math, scale, logic, evidence, facts and reality don't work for flat earthers. In short, trying to teach a flat earther how we determined the shape of the earth is akin to trying to reason with a bag of hammers.
@DrWiki-po1hk
@DrWiki-po1hk 5 дней назад
Professor Dave has been combating these ignoramuses for years now. It definitely is a problem.
@ronpapi9539
@ronpapi9539 3 дня назад
Dave is a professor of Squat.Professor Plum has a higher acceptance level and not a paid FE Debunker.
@DrWiki-po1hk
@DrWiki-po1hk 3 дня назад
@@ronpapi9539Stop talking like a toddler. Both of these individuals are infinitely more credible than the vomit you said.
@DrWiki-po1hk
@DrWiki-po1hk 3 дня назад
​@@ronpapi9539Stop talking like a toddler.
@ronpapi9539
@ronpapi9539 3 дня назад
@@DrWiki-po1hk Ptofessor Plum is a paid Debunker.Enough said.
@richardbell7678
@richardbell7678 19 дней назад
My favorite counterargument for the flat earth is that, just before sunrise and shortly after sunset, you can see clouds illuminated from below, by the Sun. On a flat earth, this is impossible and, unlike most of the other proofs that the Earth is not flat, clouds being sunlit from below is something that you can easily verify with direct personal experience.
@radiotec76
@radiotec76 19 дней назад
Ah, good one! I’ll use that.
@MelodicTurtleMetal
@MelodicTurtleMetal 19 дней назад
It works on some models. The best part about flat earth is that they don't agree with each other, and there is a solution to every single problem - though half there models only solve a single problem
@charredbirchguy2349
@charredbirchguy2349 19 дней назад
As the sun starts going under the rim, it can illuminate the undersides of the clouds. This happens just before it passes the four elephants that are supporting the Disc. Then, iirc, it also passes beneath great A'Tuin the giant turtle that supports the elephants. But I'm a little unclear about that last part.
@richardbell7678
@richardbell7678 19 дней назад
@@MelodicTurtleMetal Any flat earth model that allows the Sun to be shining upwards on the bottom of clouds does not have light travelling in straight lines, so a flat earth would seem to be a curved surface. Claiming that the earth is flat, because it looks curved is an indefensible argument.
@MrHominid2U
@MrHominid2U 19 дней назад
@@charredbirchguy2349 After that it's turtles all the way down
@lavieestlenfer
@lavieestlenfer 19 дней назад
Someone has to populate the left tail of the bell curve.
@anotherfreediver3639
@anotherfreediver3639 19 дней назад
The problem I suspect is that many would come out as quite intelligent on a Stanford-Binet IQ test. There's something else going on here; people with an IQ of less than say 70 just wouldn't be able to work out what the flat earth debate was about, because it would be too abstract for them.
@johanekman7864
@johanekman7864 19 дней назад
​@@anotherfreediver3639 No butt remember those betwen 70 and 80! Nott officialy handicaped but to stupid for the modern jobb market. I bett your typical flatt earther lies att 75 points.
@Selendeki
@Selendeki 19 дней назад
@@anotherfreediver3639 A few seconds into this video you can see a real
@Vaeldarg
@Vaeldarg 19 дней назад
@@anotherfreediver3639 The "something else" is exemplified in when at a failed Qanon event, as people started to leave someone shouted "don't leave! remember when we were alone!" These people just want there to be others (that either already do, or have been tricked by them) to be in the same boat of willful ignorance as them. Reality, much less science, moved beyond their understanding, and they gave up even trying to understand it. They just don't want to be the only one believing in the lies they've made up for themselves to explain how reality should actually be something it isn't.
@Alex-js5lg
@Alex-js5lg 19 дней назад
​@anotherfreediver3639 narcissism.
@neilthorpe7650
@neilthorpe7650 2 дня назад
Flat earthers generally fall into one of three categories: 1: Con Artist / Wannabe Cult Leader 2: Troll 3: Lonely simpleton who wants to feel special
@postgalactic
@postgalactic 2 дня назад
or 4. People that trust the evidence in the environment over the opinions of people. Have you ever made your own observations to confirm the radius value over the surface of a large body of water? You will discover that no geometric horizon exists. The horizon is optical. That is a big problem for people that like to feel special by making lists about other people that they feel superior to.
@vaporman81
@vaporman81 2 дня назад
You nailed it, bravo!
@johnqpublic7608
@johnqpublic7608 2 дня назад
@@postgalactic _" You will discover that no geometric horizon exists. The horizon is optical. "_ wrong and stupid, child. the horizon is the tangent of the observers view of the curvature of the earth. the fact that horizon can have refraction is irrelevant to it's existence. it's trivially easy to verify the spherical size and shape of the earth with nothing more than high school level math. smart people figured it out more than two millennia ago. today it's kids level stuff. maybe you can find someone to help you.
@JohnVJay
@JohnVJay 2 дня назад
Postgalactic appears to be in category 3. The first rule of Dunning-Kruger club is: you don't know you're in the Dunning-Kruger club. You don't need a body of water to "measure the curve" and determine the radius of the Earth. You don't even need to be able to see the horizon. All you need is a clear line of sight of a few hundred meters, and the right measuring equipment. Oh, and the ability to do trigonometry.
@postgalactic
@postgalactic 2 дня назад
@@JohnVJay That's all YOU need and look how far it's taken you! If the Earth is a sphere then there will be measurable spherical decline as you move away from a static observer. That's a geometric obligation and indeed a horizon must form for the observer according to that requirement. You might not like those facts but they can be tested against - and the globe doesn't hold up very well.
@jonathansantiago5327
@jonathansantiago5327 День назад
I do believe that even with the most extreme solution, it being taking a person who truly believes this conspiracy and taking them to orbit the planet, they might see it in an even bigger conspiracy, with LCD Screen windows, and so forth.
@juliavixen176
@juliavixen176 19 дней назад
You can't reason someone out of a belief that they weren't reasoned into. If their beliefs are not based on evidence, then evidence isn't going to change their beliefs. There is an emotional/psychological need that these beliefs fulfill. It's something inside of the person, not in the external world. You need to address the psychological needs to change a person's beliefs or behavior. (This is how it works in general, not just for conspiracy theorists.)
@higztv1166
@higztv1166 18 дней назад
exactly
@johnjeffreys6440
@johnjeffreys6440 18 дней назад
Ask a flat-earther to call the earth a disc instead of flat. Most won't because the earth is flat from the surface, but not from space.
@heteroerectus
@heteroerectus 18 дней назад
Yes you can, this is one of those cute little sayings that people just accept, like, fight fire with fire. You absolutely should not attempt to fight fire with more fire, it will definitely get worse. And similarly, it’s much easier to convince someone that a completely unreasonable idea that they never thought through is unreasonable than one where someone actually spent time reasoning, but got it wrong somehow. A wrong idea born of flawed reasoning or bad data is by far much harder to reason out of.
@mikewood8695
@mikewood8695 18 дней назад
and that's religion for you - and let's face it, apart from the folk at the top of religious organizations that know full well it's a scam to have power of people - and accumulate vast amounts of wealth, everyone else is believing a whole load of stuff with zero evidence - by all means have an open mind about possibilities, but to attend church or some other building with others and do what a bloke - and it is usually a bloke, tells you what to do - just another human with often very few qualifications or sign of real intelligence - is quite remarkable, but it usually involved your time and money and being subservient. All the while the hypocrisy of those at the top of those religious institutions IS just laughable - hoarding vast amounts of wealth, whilst telling us the meek will inherit the Earth - wakey wakey folk!!!
@WojciechowskaAnna
@WojciechowskaAnna 18 дней назад
Galileo was prosecuted for heliocentrism, nothing changed much since those times - majority of people, regardless of education, would build their world-view on belief, not on evidence or critical thinking. Simply because actual thinking and providing proofs to oneself requires quite an effort and curiosity. Many scientist are also rather followers than sceptics.
@chrisbullard5901
@chrisbullard5901 19 дней назад
I knew a flat earther who tried to explain how complicated the airline pilots had to fly these circuitous routes to “simulate” the Earth being round. But why would airlines spend so much more money if they could instead fly their planes in a straight line?
@drgetwrekt869
@drgetwrekt869 19 дней назад
nevermind the stupidity of science-deniers
@Toxicpoolofreekingmascul-lj4yd
@Toxicpoolofreekingmascul-lj4yd 19 дней назад
All you need to do is ask why they would go to the trouble. How does it benefit them? I've never talked to one who can answer that.
@tarunyadav3567
@tarunyadav3567 19 дней назад
​@@Toxicpoolofreekingmascul-lj4ydto sell more globes xd
@RickinICT
@RickinICT 19 дней назад
@@Toxicpoolofreekingmascul-lj4yd They'll probably just tell you it's so they can spread the chemtrails further! 😂😂
@jaimeduncan6167
@jaimeduncan6167 19 дней назад
For the same reason they pay a woman that just have a baby even when she is not working: the government forces them (great in the case of the woman). That is why Dr. Hossenfelder's type of argument: see this works, is more powerful.
@hamstergodfufurufufu8842
@hamstergodfufurufufu8842 3 дня назад
Flat earthers get the beliefs from biblical mythology and they cannot explain lunar eclipses via their myth.
@smeeself
@smeeself 3 дня назад
That can't even explain sunsets.
@hor80
@hor80 2 дня назад
Or con-men prey on them.
@garryarganis5801
@garryarganis5801 4 дня назад
the scary thing about flat earthers is that they are allowed to drive, vote, and have kids.
@doraemon402
@doraemon402 19 дней назад
The thing that sets flat earthers apart is the fact anyone can prove them wrong, unlike with many other topics that require far more complex experiments.
@drgetwrekt869
@drgetwrekt869 19 дней назад
so true. instead, there are some fields where proving some bs wrong is basically impossible or very hard (for many reasons), including one of Sabines lovers: fusion.
@catman8770
@catman8770 19 дней назад
At this point I am starting to be convinced flat earthers exist solely as a psyop to make anyone who questions anything look absolutely stupid and insane.
@MarcPagan
@MarcPagan 19 дней назад
Exactly like Dem Party voters ...Flat Earthers are fact immune.
@KendraAndTheLaw
@KendraAndTheLaw 19 дней назад
Ask them how eclipses work. The answers are most hilarious.
@user-si5ik5xf3m
@user-si5ik5xf3m 19 дней назад
Actually, you can't use facts against them or probably even the arguments. Only one will remain eligible at the end: the problem of which model is more absurd. I've argued with the russian community back in 2018 end to beginning of 2019. They just come up with some magic always. They'll bring out any magical, absurd hypothesis that can contradict their other assumptions only for the earth to remain flat.
Далее
Flat Earth "Science" -- Wrong, but not Stupid
15:50
Просмотров 1,8 млн
The Physics of Portals (Made With Love)
15:53
Просмотров 120 тыс.
How many pencils can hold me up?
00:40
Просмотров 10 млн
КАК СПРЯТАТЬ КОНФЕТЫ
00:59
Просмотров 799 тыс.
Why is everyone suddenly neurodivergent?
23:25
Просмотров 1,7 млн
Entire Chess World In Meltdown Over Bizarre New Opening
14:41
Planet of the Apes 2001: A Failed Odyssey
25:46
Просмотров 332 тыс.
We Need To Stop Lying about Plastic -- To Ourselves
8:03
My dream died, and now I'm here
13:41
Просмотров 2,4 млн
Every Kind of Bridge Explained in 15 Minutes
17:36
Просмотров 339 тыс.
Two Astrophysicists Debate Free Will
15:19
Просмотров 784 тыс.
The 10 Things That All Flat Earthers Say
18:31
Просмотров 7 млн
#miniphone
0:18
Просмотров 3,6 млн
Samsung or iPhone
0:19
Просмотров 7 млн