Right after this video went up, one of my awesome friends Sebastian designed new primers which are much much better than the CDC or other primers used in this video. Here are their sequences for those interested and if you'd like, check out Sebastian's work here: binomicalabs.org/ SpikeF - AGGAATTTTTATGAACCACAAATCA MembraneR - CGGTGATCCAATTTATTCTGTAAAC NucleoF - AAATGAAAGATCTCAGTCCAAGATG NucleoR - ACAGTTTGCTGTTTCTTCTGTCTCT
It's nifty taking those little primer sequences, doing the reverse complement, and putting it into a BLAST search, and seeing only SARS-CoV-2 come back in the results.
Hi so my question is the is a math solution how to do any kind of testing more efficiently, so is it possible to mix 4 or more samples together so it triggers if only one of them is positive?
@@RoboticusMusic They can contaminate those vegan burgers all they want. Campbell's stopped production of their split pea soup (my favorite) because of the pea shortage.
Im 26 and had covid. I had symptoms for about 16 days. It felt like a moderate cold but with severe soreness and pain in my joints, especially my legs. I have moderate asthma and my breathing was easily controlled with my inhaler. I’m also a microbiologist so this whole pandemic has been extremely interesting. This is a great video.
I had to type that name into Google. That's his real name. He even ran for political office in Australia under the 'Science Party' and is a geneticist and entrepreneur. He is a serious guy with an unusual name.
@@Queekusme Hahaha, thus needs to happen! Shirt design on back: PCR Pipette (pipette logo) Cry 😭 Repeat (uno reverse card) I would get one like this. :D
Great video but I kind of laughed at the end. Putting a "listen to the scientist" spiel at the end of a 40 minute technical video on covid testing is the definition of preaching to the choir.
@@KnakuanaRka They definitely watch videos like this, skipping through it to find bits that support their narrative and pull them out of context. Too bad this video doesnt say anything easily pulled out of context.
Meow-Ludo Disco Gamma Meow-Meow is such an amazing name. Looking him up, I learned that he got in trouble for implanting his public transport card chip into his hand and was fined and summoned to court for traveling without a valid ticket (the judge dropped the case). Sounds like an interesting friend :-)
it is INSANE how far you have come from the first videos I saw (the radio telescope/"wifi camera" adventures). the quality of science, recording, narrating, and overall production has jumped vastly; the scale and capability of your lap and tools have expanded as well; and perhaps most importantly, your passion for science and earnest pursuit of spreading knowledge has never yielded. Keep up the good work, keep yourself safe, and don't forget to take breaks sometimes so you don't burn yourself out!
And who knew, almost two years later and, well, we're still dealing with this crap. At least we've got some legit treatments now (you know, with actual scientific evidence in support of them) and a few vaccines. Though, despite getting the initial course and the first booster shot, I just recently got Covid myself (for anyone wondering, 0/10, would not recommend). I'm fine now, but it still sucked for about a week. And before you ask, I'm only in my 20s. Though, I at least don't seem to have any long term effects from it...one of my coworkers that got it really early on, relatively speaking at least (I believe it was in about November 2020) and she still can't smell or taste stuff. Which, I couldn't even imagine going through life like that. Edit: Oh yeah, and even still, +1 on the wear a mask part from a healthcare professional here (I work in a hospital lab). They really can make a difference. Although, I'll also say that while the cleaning EVERYTHING before bringing it into your house was solid advice at the time this video went out, turns out, SARS-CoV-2 doesn't spread that great on surfaces, so that isn't as necessary as originally thought. Still not bad advice in general, just not a major factor in terms of Covid-19 spread. Edit 2: oh yeah, and another thing, that is only relevant now that it's been a while since the video came out...The false negatives are far less common nowadays. They absolutely were a huge issue early on (i.e. back when the video was posted), but nowadays the tests are quite reliable, even for the newer variants. Edit 3: Just one more thing I wanted to add regarding PCRs...if you've never been around a hospital lab style PCR, the thing I think that'll stick out the most is they are loud. Like, really, really loud. At least, the ones we use are absurdly loud. It's reminiscent of what a jet engine sounds like from inside the plane. So not loud enough to require earplugs, but loud enough that it's very clear something is happening. Of course, the PCRs at the hospital are more than just the block that heats and cools to specific temperatures. I mean, yeah, it has that part, but it also does all the measurements and detection internally. No gel electrophoresis or additional manipulation of the sample. It's literally just mix the UTM from the swab with the reagents, load, and await results. So it's possible the PCR like described in the video isn't quite as noisy, but I'm far from an expert on the stuff lol. Oh, nice, he talks about the difference in the diagnostic PCRs vs the one he initially described. Should've just kept watching Edit 4: and now I suddenly know why some samples we've tested consistently come out with an "inconclusive" result. None of us were quite sure the reason behind it, and after watching the video, well, I still don't know the underlying mechanism but at least I know the problem. One of the two primers came up positive, the other negative (and the human gene control part worked). Thus, the machine would've given an inconclusive result, despite multiple tests on the same sample. We always just give up and ask the nurse to recollect after it comes up inconclusive twice, and 999/1000 that solves the problem. So I still couldn't say why the initial sample was problematic, but at least I know the reason the machine insisted on giving a result of inconclusive.
I clicked as soon as I saw the patreon notification. Fantastic job on the animations. I can tell you really put your blood sweat and tears into this project. (sometimes literally) I also really appreciate that you didn't pull any punches for anti-maskers and conspiracy theorists. It's a bummer bad primers caused you so much trouble but I think the final product is some of your best work. I'm pretty hyped for the upcoming spider silk video. Keep up the good work Justin!
As a healthcare professional I enjoyed your brief but scientific comprehension very much, to say it clear I love Your video! Thank you very much. (Of course I recommended it to many nerdy friends!) But I've been a bit suspicious with the Immunglobulines: As far as I know IgA (which is not present in your diagrams) is the only dimer (in humans), and IgD, which you present as a dimer is a monomer like IgE and IgG, too. Correct me if I am wrong!
- "If you think this is bad ooohh weee are you in for a surprise as climate change ramps up". I know this vid is about the coronavirus but i think more people need to realise this. Climate change cannot be compared with little things such as a pandemic, a complete collapse of the economy and growing inequality. Everyone agrees that 2020 is going to be remembered as one of the most sucky years of modern history. What we need to understand as a species is that climate change is going to make it so that every year is like 2020 all the time but then it is going to keep getting worse. We are not killing the planet. We are just destroying the intricate balance on which our way of life is based.
as a scientist like yourself, do you ever question the origins of COVID? do you think that there is anything you find uncertain or questionable about the virus?
People are so caught up with deaths that they don't consider what happens to the survivors after - no matter if the illness was severe or mild. I had a 'mild' case, and I still have abdominal discomfort, occasional shortness of breath, and fatigue. Symptoms started on july 14
"Long-haulers" aren't unique to covid. A lot of people who are diagnosed with CFS/FM (chronic fatigue syndrome, fibromyalgia) likely started out with infections.
at about 31:00 you state that people with past infections don't PCR test positive - actually, a surprising amount of people test positive weeks after a passed infection, due to "genetic garbage" still hanging around. These patients are, according to WHO standards, not considered infectious patients anymore. Do you know what this "genetic garbage" actually is? How long can naked pieces of RNA just hang out on mucous membranes?
I know a guy that kept testing positive over and over. Finally somebody told him to rinse his sinuses out with saline. He did it three times a day for 8 days and finally tested negative.
RNA is officially a proteïne so it can take a long time for it to break down under the temp it was meant to be in. (sorry i dont have a concrete number)
How is there almost a 7:1 like to dislike ratio on this video? You would think the people subscribed to this channel would be the sort to know better than to subscribe to baseless conspiracies. Not to mention you clearly spent a lot of time thoroughly researching this and cited sources that they could check and see are reputable.
People are eternally disappointing, and the number of comments alleging that the whole thing is a hoax should explain where it's all coming from. A vocal minority, but thankfully a minority none the less
@@C2H5OHist Same here. The political digs undermine the credibility of the video. If I can spot fallacious reasoning/data on things I am well informed about, it makes me question whether I can trust him on things I am not and came to the video to learn more.
You can use aquarium gravel instead of frozen peas! Can even use it to flash freeze stuff if you have access to a -80°C freezer. Keep up the good work! Your videos are interesting to watch even for us who work in labs all day long.
I can't believe I sat through this looong video about a field of science that I knew nothing about and actually learned something. This is some high-quality content.
@@Ryan6.022 I'm imagining a hyper intelligent grad student that went on a psychedelic vision quest of a lifetime. From this he gained a sense of humor, a sense of purpose, and superhuman powers of chill. I've had friends attempt to rename themselves after a heavy trip, and none of them were this cool.
the people watching these kinds of videos mostly are the people who already know it's bad. if there was a way to force this video's knowledge on everyone and force them to have a high enough IQ to comprehend it, then that would be a wakeup call. But no, the only brainwashing technology we have is 5G and coronavir- wait...
Yeah at this point everyone has already formed their opinions on this whole situation, and that usually only changes when someone who downplays covid loses a family member.
From what I have seen, I doubt the wakeup call will work either. I have seen plenty of people say "it'll all be over after the election" or similarly stupid nonsensical bullshit. All while having a friend or family member disappear to their home for a few weeks with COVID-19. They literally do not see or hear it happening right in front of them.
Please be careful about recommending ubiquitous testing. At very low prevalence levels, (sub the "prevalence threshold" for the test), the precision (PPV) drops rapidly. In places like NYC, where the prevalence is 1% or less, a large majority of positives end up being false. Until tests get to ultra-high >99.9% specificity, the prevalence threshold, given their sensitivity, is >3%.
Getting a false positive is way less of an issue than missing a case, because the worst that can happen to you in that case is getting isolated, which you should be doing anyway
Actually kind of blown away that you just exploit the RNAs goal to self replicate but do it in a lab and look for the result that it’s duplicated exponentially 🤯
Instead of disliking the video, read the citation in the description and check the sources, and then compare that to the citation of sources that says otherwise, if said citation exists at all
Where I live, we’ve only had 27 cases (all recovered with no deaths nor community spread) and it’s been almost two months without a case. Hearing about what’s happening in the rest of the world seems fake, though I know that it is, unfortunately, true. All we did was follow our public health guidelines. ITS NOT THAT HARD!
My county has 15 imported cases (that were detected) through people returning from their holidays. School starts again next week. This is gonna be great.
39:12 I was almost as impressed by the fact that the auto-subtitles transcribed "Cheeto von Gropensnatcher" correctly as by the quality of the video ^^
Wow, I've used TLC a lot at the medicinal chemistry lab to monitor chemical reactions. Those anti-body tests are like ultra overdrive TLC, it's awesome
I think it's interesting that at the beginning of your video you basically say that no political talk should be made in the comments, then you go on to make a lot of political statements for 5 minutes at the end of your video. That being said, it's a great video, but I lost the ability to use this in my classroom when you went on a political rant at the end. I love your videos, and I hope you'll make one about T-Cell immunity because it gets old explaining it to people who don't understand even the most basic parts of biology. Keep up the good work!
It is simply outdated at this point. The downside to such long videos is that you can't select for the information that withstood the test of time and set aside the parts that aged poorly.
I’m not sure if I’m taking your final point the wrong way but I thought it was quite controversial. Yes this is a temporary “new normal” and it kind of is a new normal in the sense that once we get over this virus we will react like Asian populations have done for decades aka wear a mask if you are sick. I’m not sure if you were implying that you’ll have to wear a mask for the rest of our lives, constantly? Correct me if I’m wrong on that one. We will get back to normal without the constant need to wear masks. We will socialise in bars pubs and clubs again. We will go on holiday again. All without social distancing and masks. It should be a selective thing. We need to encounter disease for our bodies to protect against them (I won’t patronise you because you’re well qualified for this OBVIOUSLY🤣). Masks won’t be weird anymore, people will wear them when they deem fit (after this pandemic) and people will be more open minded about wearing them. I think the problem with this virus was the initial uptake of masks either because they felt embarrassed or they thought it was stupid which is a valid reason because yes it is weird, but now it’s a whole new kettle of Fish people will have a much much faster reaction to future pandemics (if that’s what you mean by new normal). We can’t and won’t constantly wear masks after this virus has been contained and defeated, it’s just not socially viable, we are very social species and masks hinder our ability to connect with people. I’ve not been outside in weeks and I’ve only been outside 5 times in the past 3 months and that’s terrible because I’m feeling a little depressed. I’m doing my chemistry lectures from my bed and I’d say I easily spend 23.5 hours in bed which is utterly dreadful. At the start of the pandemic I’d go on 125km cycles twice a week for about 6 months going 25km walks but now I’ve been broken I guess. I’m in the Royal Air Force and I’ve have not flown in 11 months I’ve missed hundreds of hours of flying and activities I’m so sad. What I’m trying to say is we cannot and will not continue living like this and we will go back to a full normal with added reactions. This is all about gaining a valid reaction to this so we are prepared in the future, whether that’s from governmental spending in science, social norms in the sense of masks and social distancing, we will be more prepared for future iterations of this generation killer.
@@WarningStrangerDanger Yes, 100%, but also the actual virus for everyone who isn't the age of 60 or has severe immune compromises, it has a 99.9% survival rate.
"RT" in "RT-PCR" stands for Reverse Transcription (or Transcriptase), not Real-Time. qPCR is quantitative PCR (real-time), and "Real Time RT-PCR", or "rRT-PCR" or even "RT-qPCR" is real-time RT-PCR. 😊
I'd like it to be that way, but RT-PCR was actually used as a name for qPCR for a while and some stubborn research groups are still doing it like that.
He really put his blood, sweat, and tears into this video. He pricked his finger, did some pipetting, crying and repeating, and worked on this video for months. Awesome video.
If teachers could spend DAYS/weeks making a video about a single example of a single topic, that would be true, but then an undergrad degree would take about 2 decades to complete.
they shortened the loop mediated etc part to L and then used Amp for amplification. It's actually a pretty clever solution to give it a memorable name.
I have been looking for something like this for a long time, thanks. The only thing I disliked was the ”Don't be alarmed. But be alarmed, this is the new normal”-bit. In Finland we have a lot of new cases now, but zero people in intensive care for a month, and a just handful getting hospital treatment, even as very few bother with the masks. Is this because hand washing, distancing and protection of risk groups have been effective, or has something happened to the virus itself during summer? It is mutating, after all. I think the jury is still out on near future developments.
Why should I wear a mask in public if I touch my face more when I wear one? Also, if a test takes a stick up my nose or in the back of my throat why do I need a mask? If breathing in someone will spread the virus couldn’t I just breath on or spit on a stick instead? Also, if the day to day masks won’t stop things like the virus then why wear one? I’m a firefighter so I took an exam on all sorts of masks. These masks don’t stop viruses. Wouldn’t it be better to always wash your hands, cough and sneeze in your sleeve and use hand sanitizer a lot?
Masks don't 'stop' anything. Instead, the decrease the distance your respiratory droplets can travel, thus, they decrease the chance of spread. Maybe you'll touch your mask, but surfaces are much more easy to clean than invisible droplets? I don't even know why that's an argument anymore. Sanitize and wear a mask.
@@coolcucumbers7601 maybe you don’t understand the word stop in this context. Here’s an analogy that might help. If you try to fit a fridge into a hula hoop it won’t fit. The same goes for viruses. You may think it shortens the distance but idk if you know how small a virus really is. It might stop water droplets but it won’t stop the virus.
@@coolcucumbers7601 viruses don’t have to be attached to water droplets or anything to survive. If they wanted to survive for an extended period of time they’d have to but in the case of a mask, a mask may decrease the distance of the water droplets but it won’t stop the virus from going through
@@rosspeterson2658 , I know they don't have to be attached to water to survive man. It's just how it works. when you breathe or sneeze, or cough, it's not like your respiratory droplets are going to miraculously divide into viruses and water. The droplets that come out contain the virus. That doesn't mean that the virus needs the liquid, it's just inside it because the fluid came out of that persons system . The virus is secondary. Take this comparison. If you try to blow out a candle without a mask, easy right? but when you do it with a mask, hard right? But I can assure you that carbon dioxide is much smaller than a virus. Sure, some of the droplets may come out, but masks make it so that you can't breathe out as hard, not tha it's that noticeable after a while.
That moment when you realize how much more science you need to learn... and the moment persists throughout the video. Sadly, my rudimentary understanding of bioscience may have dampened the intended response to this information - but I am now taking this issue more seriously. Thank you for this extended content, good sir.
I hate how the most common anti-mask argument is "It gives people a false sense of security and they stop social distancing". Because simply educating people is too hard.
man it is depressing to know that we used to think there was a chance wed do something about all this instead of just arbitrarily deciding it was over when it wasnt and refusing to do anything more
38:35 This is something that people need to understand. People and the media get way to fixated on the mortality rate, but this is not the flue and the virus can do long lasting, live-changing damage in your body.
@@olivercharles2930 You are just as dangerous as the people pushing radioactive health wear, you just don't know it yet. The above video was made almost a year after the pandemic began so I can forgive his ridiculous opinions, but I'm guessing any reasonable scientist would reflect on his own personal opinions about the future of society post-pandemic and say, 'Gee, I got that wrong.' without being too offended.
@@VariantAEC You speak confidently for someone ignoring all the reasonable scientists saying the opposite of your claims. But hey, only the ones regurgitating the opinions you have matter, right? Peak confirmation bias right there.
@@olivercharles2930 After 2021, all the reasonable scientists changed their minds about masking up. Weird, right? Also, I didn't say this video was bad, nor did I even imply that the non-opinion based content was bad or wrong in other threads. Elsewhere under this very same video, I commended the work of this video's creator. The issues with his personal views are the reason I didn't like the video, but his explanations of the processes of testing for a virus are the reason I didn't dislike it. Why do so many people like you get so upset that the reasonable people are in the middle. If you and people like you made more sense overall than you and your 'opposition,' I'd agree with you and your side more. Somehow, you can't ever just step back and see that the problem can be you and your side.
@@VariantAEC Except for the fact they didn't. All reasonable scientists agree that a mask was a small, but necessary step to minimize the spread of the disease. Oh, and the reason I "get so upset" is that seeing someone casually deny science while pretending to be "reasonable" is aggravating. Maybe you should rethink your beliefs if all you seem to get is criticism? Nah, it must be the scientists who are wrong!
Gels. Very fun, until it turns out that when your fridge broke all your enzymes went with it. Context, I'm a biotech student in high school (long story to explain), so have done a few gels. At the beginning of the year, one of our fridges with our digestive enzymes broke and unfortunately after two failed gels we figured out the enzymes were not salvaged in time.
I love your videos and learn so much from them, but i have a confession to make when I'm having a hard time sleeping ill play one of your videos and it knocks me right out.
This is unique content on youtube, i have not found anything similiar to it. I love your channel, altough i dont understand anything. Guess i will stick with my area of expertise. Great work tho.
What a hell of an in-depth video about COVID-19 and how the tests work. And thank you for pointing out the simple things like wearing a mask and getting tested if you even SUSPECT you've been exposed. I'd be a patreon if I could, but can't afford to yet.
Bob Bobbertson think of it in the terms of a drunk dude naked. If you’re both not wearing pants and he takes a leak on you, you’re both wet. If you’re wearing pants and he isn’t, you get wet but much slower. If you’re both wearing pants, then he’s the only one getting wet. Using a mask is to protect others from you, not necessarily you from others. The exception being N95 or higher masks or those certified for viral loads.
I work on software for an automated processing platform (qPCR and microarray), and it is nice to understand a bit better about how the primers and fluorescence markers work. The only real understanding I had to have was: it grows a lot and glows in this specific way if you do "biology stuff" to it. But it is nice to know what the colleagues are actually up to.
This is a really detailed and amazing video! This information is important for the public to know, and I'm glad you're putting it out there. I hope my videos become as well-explained as yours one day haha :D
n95 is the only thing that truly works. agree, cloth masks do help with direct 💧 transfer. i.e. coughing, sneezing etc. the combo of WASH YOUR FREAKING HANDS PEOPLE and, cough cough( I hate masks but....)wearing masks is the ideal situation. I personally watched as a workplace went from zero covid illnesses for the entire past 2 1/2 years with 189 active workers in ~100,000 sq ft facility to literally having 19 confirmed cases in one week with a follow-up of 13 and 9 the following 2 weeks respectively. the biggest difference I noticed was the decay of full cleaning before and after every shift change with heavy disinfecting during shifts with 100% masks required while in the facility. the disinfecting regiment, I personally feel had the biggest impact, slowly fizzled away while masks was what Senior leadership hung their hats on. I noticed that this past december(weeks before the outbreak) it was so relaxed with disinfecting that we didn't even have "bleech wipes" in stock. anyway.... just an observation I made. interesting.
Hi Justin, I’ve been binging these videos since I found them. I’m very interested in this line of work but am a physics junior already, with plans for a masters in electrical engineering, so my time to branch into biology while in undergrad is limited. Do you have any suggestions on classes to take that would set me up well to combine engineering, physics, coding, and bio? Or suggestions on extracurriculars or diy stepping stones? Thanks to you I’m looking into a magnet implant, depending on my future specialization, this could be super useful.
The easiest way to get started is probably on your own, but there's nothing stopping you from taking an intro to bio or biochem class. Though fair warning, they'll bombard you with an enormous amount of information. But if you just want to learn on your own, crash course has a bunch of great series on the topic. I also suggest the book "the manga guide to molecular biology". It's cute, well written, and covers a ton of stuff. Beyond that, look at places like amino.bio, biobits or carolina biological and get yourself one of their fantastic kits. You'll get some hands experience and get to see how some of this stuff works for yourself
What a coincidence I’m studying molecular biology at university but maybe want to stem out into physics. Maybe biophysics? There are similarities between biology and physics which may be surprising like molecular motors. Anyway good luck with your journey !
I am so glad you made this video! You are educating so many people about such a serious problem and it is honestly people like you that are keeping this world alive. Keep up the amazing work man :)
Would an antigen test be set off by someone who had been vaccinated? I assume no, because the person wouldn't be actually producing the antibodies, but I'm not entirely sure and I might need to take a rapid antigen test while literally across the country with no way home.
Thanks for this great video - really informative to people with sufficient knowledge. As I studied Biotechnology, we did PCR in the University lab, and we all experienced similar problems as the ones shown here, although I never in clinical setting. Based on experience and stability of RNA, it makes me wonder: 1. Can we quantify the odds of a true positive? I guess it's 3 divided by the total number of things, which may go wrong in the process. 2. For the second type of RNA test, I will do some reading - I wonder how lowering pH impacts the sample in the process and why the false negatives are less likely than more positive. 3. For the antibody test, I wonder if all SARS-Cov-2 proteins are being tested for, and whether an immune response via CD8 cytotoxic T-cells which detect infection via the MHC receptors, can be detected? 4. Also, if antibodies were produced in response for another Coronavirus, which also bind to SARS-cov-2 proteins, how we avoid the false positive? 5. It's not the first time I hear that coronavirus mutation -a simple RNA virus - it mutates more slowly than say HIV virus, and I'm struggling to understand the reason. My understanding is virulence and spread of disease increases the mutation chances and HIV is transmitted by means of sex or blood transfusion. Anyone have a good source of reading or simple explanation why mutation would be slower here? Thanks and again - great video - might be a bit sceptical on test accuracy and impact of the new normal on the demographic crisis - but definatelf quite interesting and a deeper dive details may interest folks like me!
All of that logic and he couldnt reply. It would undermine his and their entire theoretical superiority complex over a 97% +/- survivable virus. Thank you for sharing this beautiful knowledge.
For all the plague lovers: I know that you are suicidal (from stupidity), but please don't kill other people. And for the rest of us, here is a quote: “A new scientific truth does not triumph by convincing its opponents and making them see the light, but rather because its opponents eventually die, and a new generation grows up that is familiar with it.” - Max Planck
My parents got the antibody test n my dad was positive so he got a pcr, came positive, i had a slight flu, came positive, my cousins entire fam except their dad n one bro got positive (including a 5 month old) but we’re good now so
Actually the “masks don’t protect you they protect people from you” that’s not true. Ask any nurse or doctor and they say when they go into surgery it’s to protect themselves from and the patient. It goes both ways
Seeing that ending now... Oh boy, I sure love how we all got together and tried to solve every important problem we had! In any case, thanks for your videos man. I am not in the biomedical field but I love watching your videos and hopefully learning something useful.
fragments don't persist inside bodies. They are rapidly broken down. For the test to be positive active replication needs to be happening to renew the supply of detectable RNA
@@thethoughtemporium Right that makes sense; the big issue with testing for subgenomic rna of covid is that it’s stable even post-infection, but that wouldn’t be the case for the viral dna. Thanks!
I was expecting to see something on the PCR thresholds, but they weren't mentioned. What are your thoughts on the recommended threshold of up to 40 cycles? Also, would appreciate any insight on why breakthrough cases only get up to 28 cycles. Thanks!
“250 more death by the time you watched this video” Me thinking video is 15 min long: oh shit, that’s like 2 death a min or somt Me seeing that it’s 48 min long: oh ok but still
I love how I dropped out of school and the first GED test I take I passed with pretty much just 7th grade biology. And here I am still interested in these topics. Then again maths and science were my middle school strong suits.
I'm shipping out for military service soon... they moved my ship out date from dec 17 to oct 14 --allegedly because of covid infections but that's up for debate What I do know is the paranoia on my end is *real* considering that, at least in my small town, no one seems to take covid seriously with schools recently opening back up I feel like things are only gonna get worse
I really hope Meow Ludo Disco-Gamma Meow Meow has or is working on a PhD because I want to live in a world where a highschool student can turn in an assignment and cite a source as the research of Dr. Meow Meow.
Finally a comprehensive video on this subject. Love your content in general, but this particular video needs to reach a wider audience. I hope that the algorithm picks this up.
I can’t wait for the year 2121 when all the high school history classes will be watching these kind of videos sort of like us watching videos of a gas mask psa’s back in the war
